COMPOSITIONS AND METHODS FOR DETECTION OF GROUP B NUCLEIC STREPTOCOCCAL ACID

专利摘要:
The present invention relates to nucleic acid oligomers, comprising amplification oligomers and detection probes, for the detection of group B streptococcal nucleic acid (GBS; Streptococcus agalactiae). The invention also relates to methods for the specific amplification and detection of nucleic acids using the oligomers described, as well as reaction mixtures and corresponding kits.
公开号:BE1026527B1
申请号:E20195528
申请日:2019-08-13
公开日:2020-10-12
发明作者:Renaud Close；Laurent Franzil；Barbara L Eaton；Benjamin Grobarczyk；Yves Ozog
申请人:Gen Probe Inc；
IPC主号:

专利说明:

COMPOSITIONS AND METHODS FOR DETECTION OF NUCLEIC ACID AT BE2019 / 5528
GROUP B STREPTOCOCCUS BACKGROUND OF THE INVENTION Group B streptococcus (GBS), or Streptococcus agalactiae, is a gram-positive bacterium associated with transient colonization of mucous membranes throughout the body, including the vagina, gastrointestinal tract. , and the urethra. GBS rarely causes disease in healthy people, but can cause serious illness in immunocompromised patients, the elderly and newborns. Of particular concern is neonatal infection caused by vertical transmission during labor and delivery. Transmission from an asymptomatically colonized mother to the newborn can result in early-onset invasive GBS infection, the leading cause of sepsis and meningitis in newborns in the United States. Early-onset invasive GBS infection in newborns can lead to death or long-term disabilities, such as mental retardation, hearing or vision loss. Buchan et al., J. Clin. Microbiol. 53: 443-448, 2015.
Identification of GBS during routine screening leads to the administration of intrapartum prophylaxis aimed at reducing bacterial transmission and reducing the risk of invasive disease. Implementation of this screening and prophylaxis strategy reduced the incidence of early-onset GBS from 60% to 86%. Lin et al., Am. J. Obstet. Gynecol. 184: 1204-1210, 2001. As of 2010, CDC guidelines include molecular diagnostic testing as an option in addition to or in addition to culture. Current tests include the Cepheid GBS LB and BD max GBS tests, which target the CFB gene.
There is a need in the art for GBS assays exhibiting improved sensitivity and / or potential for protection against isolate variance of a single gene, including, for example, assays capable of detecting GBS Ia serotypes, Ib, Ic, IL, III, IV, V, VL VIL VII and IX, comprising the non-hemolytic isolate.
Summary of the Invention In one aspect, the present invention provides a composition for determining the presence or absence of group B streptococci (GBS) in a sample. In some embodiments, the composition comprises a first combination of amplification oligomers and / or a second combination of amplification oligomers, BE2019 / 5528 where (D the first combination of amplification oligomers comprises first and second S / P specific amplification oligomers capable of amplifying a target region of a GBS S / P target nucleic acid, wherein the first and second SIP specific amplification oligomers comprise, respectively, first (A) and second (B) S / P specific target hybridization sequences selected from (a) (A) SEQ ID NO: 3, or an RNA equivalent or DNA / RNA chimera thereof, and ( B) SEQ ID No: 4, or an RNA equivalent or a DNA / RNA chimera thereof; and (b) (A) SEQ ID No: 7, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 8, or an RNA equivalent or DNA / RNA chimera thereof; and (ID the second combination of oligomers amplification includes first and second CFB-specific amplification oligomers capable of amplifying a target region of a CFB-to-GBS target nucleic acid, wherein the first and second CFB-specific amplification oligomers comprise, respectively, first (A ”) and second (B ') CFB-specific target hybridization sequences selected from (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID NO: 26, or an equivalent of 'RNA or a DNA / RNA chimera thereof, and (B') SEQ ID NO: 13 or SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof. -this ; (b) (A) SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID No: 18, or an RNA equivalent or a DNA / RNA chimera thereof, and
(B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof; and (d) (A ") SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
In certain embodiments of a composition as above, where the composition comprises the first combination of amplification oligomers, the composition further comprises an S / P-specific detection probe oligomer comprising a hybridization sequence. S / P-specific detection probe target that is about 15 to about 35 nucleotides in length and that is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second oligomers of amplification specific to S / P. In some of these embodiments, the first and second S7P-specific target hybridization sequences are the target hybridization sequences of (I) (a) and the S / P-specific detection probe target hybridization sequence. is SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof. In other embodiments, the first and second SZP-specific target hybridization sequences are the target hybridization sequences of (I) (b) and the S / P-specific detection probe target hybridization sequence. is SEQ ID NO: 11, or an RNA equivalent or DNA / RNA chimera thereof. In some variations, the S / P-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In certain embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the S / P specific detection probe oligomer further comprises a non-fluorescent quencher.
In some embodiments of a composition as above, where the CFB-specific target hybridization sequences are the target hybridization sequences of (ID (a), the first CFB-specific target hybridization sequence of ( ID (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a DNA / RNA chimera thereof. In some of these embodiments, the first hybridization sequence CFB-specific target of (ID (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or DNA / RNA chimera thereof; in some of these variations, the former CFB-specific target hybridization sequence of (ID) (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera thereof. other embodiments, where the CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (a), the first CFB-specific target hybridization sequence BE2019 / 5528 of (IT) ( a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof. Particularly suitable first (A ") and second (B ') aCFB specific target hybridization sequences of (ID) (a) include () (A) SEQ ID NO: 12, or an RNA equivalent or chimera DNA / RNA thereof, and (B ') SEQ ID NO: 13, or an RNA equivalent or DNA / RNA chimera thereof; (ii) (A) SEQ ID N °: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof, here; (c) (A) SEQ ID No: 14, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (iv) (A ") SEQ ID NO: 18, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof.
In certain embodiments of a composition as above, where the composition comprises the first combination of amplification oligomers, the composition further comprises a CFB-specific detection probe oligomer comprising a target hybridization sequence of CFB-specific detection probe which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB-specific amplification oligomers. In some of these embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (b) and the CFB-specific detection target hybridization sequence is SEQ ID N °: 24, or an equivalent of RNA or a DNA / RNA chimera thereof; the first and second CFB-specific target hybridization sequences are target hybridization sequences of (ID) (d) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or a RNA equivalent or a DNA / RNA chimera thereof; the first and second CFB specific target hybridization sequences are the target hybridization sequences of (ID) (a) and the CFB specific detection probe target hybridization sequence is SEQ ID No: 22 or SEQ ID N °: 23, or an equivalent of RNA or a DNA / RNA chimera BE2019 / 5528 thereof; or the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (c) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In some embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
In some embodiments of a composition for determining the presence or absence of GBS in a sample such as the above, the composition includes both the first and second combinations of amplifying oligomers.
In another aspect, the present invention provides a composition for determining the presence or absence of GBS in a sample, wherein the composition comprises a combination of amplification oligomers comprising first and second amplification oligomers specific to S. / P capable of amplifying a target region of a SIP target nucleic acid to GBS. Particularly suitable first and second S / P-specific amplification oligomers comprise, respectively, first (A) and second (B) SZP-specific target hybridization sequences selected from (a) (A) SEQ ID NO: 3 , or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 4, or an RNA equivalent or a DNA / RNA chimera thereof; and (b) (A) SEQ ID NO: 7, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 8, or an RNA equivalent or a DNA / RNA chimera thereof.
In some variations, the composition further comprises an SP-specific detection probe oligomer comprising an S / P-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured. to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second S / P specific amplification oligomers. In some of these embodiments, the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a) and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: : 9, or an RNA equivalent or DNA / RNA chimera thereof. In other embodiments, the BE2019 / 5528 first and second S / P-specific target hybridization sequences are the target hybridization sequences of (b) and the S / P-specific detection probe target hybridization sequence. P is SEQ ID NO: 11, or an RNA equivalent or DNA / RNA chimera thereof. In some variations, the S7P-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In certain embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the S / P specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations of a composition as above, the composition further comprises a second combination of amplifying oligomers capable of amplifying a target region of a target nucleic acid CFB to GBS.
In another aspect, the present invention provides a composition for determining the presence or absence of GBS in a sample, wherein the composition comprises a combination of amplification oligomers comprising first and second amplification oligomers specific for CFB. capable of amplifying a target region of a CFB to GBS target nucleic acid. Particularly suitable first and second CFB-specific amplification oligomers comprise, respectively, first (A) and second (B) CFB-specific target hybridization sequences selected from (a) (A) a sequence which is about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID NO: 26, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 13 or SEQ ID No: 15, or an RNA equivalent or DNA / RNA chimera thereof; (b) (A) SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof; and (d) (A) SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
In some embodiments, the first CFB-specific target hybridization sequence of (aBE2019 / 5528 comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or DNA / RNA chimera thereof. -this.
In some of these embodiments, the first CFB-specific target hybridization sequence of (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or DNA / RNA chimera of this one ; in some of these variations, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera of these.
In other embodiments, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof.
Particularly suitable first (A) and second (B) CFB-specific target hybridization sequences of (a) include (1) (A) SEQ ID NO: 12, or an RNA equivalent or DNA construct / RNA thereof, and (B) SEQ ID NO: 13, or an RNA equivalent or DNA / RNA chimera thereof; (ii) (A) SEQ ID NO: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID No: 14, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (iv) (A) SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof.
In some variations, the composition further comprises a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured for s 'hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB specific amplification oligomers.
In some of these embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b) and the CFB-specific detection target hybridization sequence is SEQ ID NO: 24 , or an RNA equivalent or DNA / RNA chimera thereof; the first and second CFB specific target hybridization sequences are target hybridization sequences of (d) and the CFB specific detection probe target hybridization sequence is SEQ ID NO: 25, or RNA equivalent or a DNA / RNA chimera BE2019 / 5528 thereof; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a) and the CFB-specific detection probe target hybridization sequence is SEQ ID No: 22 or SEQ ID No: 23, or an RNA equivalent or DNA / RNA chimera thereof; or the first and second CFB specific target hybridization sequences are the target hybridization sequences of (c) and the CFB specific detection probe target hybridization sequence is SEQ ID NO: 23, or equivalent of RNA or a DNA / RNA chimera thereof. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In some embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations of a composition as above, the composition further comprises a second combination of amplifying oligomers capable of amplifying a target region of a target nucleic acid S / P to GBS.
In another aspect, the present invention provides an aqueous formulation for the amplification of GBS nucleic acid comprising a composition as above and an organic buffer. In certain embodiments, the aqueous formulation further comprises at least one component selected from a DNA polymerase enzyme, a reverse transcriptase enzyme, a detection probe oligomer, and a blowing agent (eg, trehalose, raffinose, or a combination. of these). In some embodiments, the aqueous formulation contains an inorganic salt at a concentration of 4 mM or less. In another aspect, the present invention provides a reaction mixture for the amplification of GBS nucleic acid comprising an aqueous formulation as above.
In another aspect, the present invention provides a dried formulation for the amplification of GBS nucleic acid comprising a composition as above and a blowing agent. In some embodiments, the blowing agent is trehalose, raffinose, or a combination thereof. In some embodiments, the dried formulation further comprises at least one component selected from an inorganic salt, a DNA polymerase enzyme, a reverse transcriptase enzyme, and a detection probe oligomer. In some embodiments further comprising an inorganic salt, the mass percentage of the inorganic salt relative to the mass of the dried formulation is less than or equal to 0.249%. In some variants, the dried formulation is a BE2019 / 5528 lyophilized formulation.
In another aspect, the present invention provides a reaction mixture for amplification of nucleic acid at GBS, wherein the reaction mixture is reconstituted with water or an organic buffer from a dried formulation as above. .
In some embodiments, the reaction mixture contains an inorganic salt, for example, magnesium, potassium or sodium; in some of these variations, the concentration of the inorganic salt is less than or equal to 4 mM.
In another aspect, the present invention provides a kit for determining the presence or absence of GBS in a sample.
In some embodiments, the kit comprises a first combination of amplification oligomers and / or a second combination of amplification oligomers, where (D the first combination of amplification oligomers comprises first and second oligomers d 'S / P-specific amplification capable of amplifying a target region of a GBS S / P target nucleic acid, wherein the first and second SIP-specific amplification oligomers comprise, respectively, first (A) and second ( B) S / P specific target hybridization sequences selected from (a) (A) SEQ ID NO: 3, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 4, or an equivalent of RNA or a DNA / RNA chimera thereof; and (b) (A) SEQ ID NO: 7, or an equivalent of RNA or a chimera d 'DNA / RNA thereof, and (B) SEQ ID NO: 8, or an RNA equivalent or DNA / RNA chimera thereof; and (ID the second combination of oligomers of amplification includes first and second CFB-specific amplification oligomers capable of amplifying a target region of a CFB-to-GBS target nucleic acid, wherein the first and second CFB-specific amplification oligomers comprise, respectively, first (A ”) and second (B ') CFB-specific target hybridization sequences selected from (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID NO: 26, or an RNA equivalent or a DNA / RNA chimera thereof, and BE2019 / 5528 (B) SEQ ID NO: 13 or SEQ ID No: 15, or an RNA equivalent or a DNA / RNA chimera thereof ; (b) (A) SEQ ID No: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID No: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (d) (A ") SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
In certain embodiments of a kit as above, where the kit comprises the first combination of amplification oligomers, the kit further comprises an SP-specific detection probe oligomer comprising a target hybridization sequence of S / P-specific detection probe that is about 15 to about 35 nucleotides in length and that is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second specific amplification oligomers at S / P. In some of these embodiments, the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (1) (a) and the SIP-specific detection probe target hybridization sequence. is SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof. In other embodiments, the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (D) (b) and the SIP-specific detection probe target hybridization sequence. is SEQ ID NO: 11, or an RNA equivalent or DNA / RNA chimera thereof. In some variations, the S / P-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In certain embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the S / P specific detection probe oligomer further comprises a non-fluorescent quencher.
In certain embodiments of a kit as above, where the CFB-specific target hybridization sequences BE2019 / 5528 are the target hybridization sequences of (ID) (a), the first specific target hybridization sequence to CFB of (ID) ((a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a DNA / RNA chimera thereof. In some of these embodiments, the first CFB-specific target hybridization sequence of (II) (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or DNA / RNA chimera thereof; in some of these variations, the first CFB-specific target hybridization sequence of (IT) (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or a DNA construct / RNA thereof In other embodiments, where the CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (a), the first CFB-specific target hybridization sequence of (ID) (a) e st SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof. Particularly suitable first (A ") and second (B ') aCFB specific target hybridization sequences of (ID) (a) include (1) (A) SEQ ID NO: 12, or an RNA equivalent or an DNA / RNA chimera thereof, and (B) SEQ ID NO: 13, or an RNA equivalent or DNA / RNA chimera thereof; (ii) (A) SEQ ID N °: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof, here; (iii) (A ") SEQ ID No: 14, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 15, or a RNA equivalent or a DNA / RNA chimera thereof; and (iv) (A) SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof.
In certain embodiments of a kit as above, where the kit comprises the first combination of amplification oligomers, the kit further comprises a CFB-specific detection probe oligomer comprising a target hybridization sequence of CFB-specific detection probe which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second specific amplification oligomers BE2019 / 5528 CFB. In some of these embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (b) and the CFB-specific detection target hybridization sequence is SEQ ID N °: 24, or an equivalent of RNA or a DNA / RNA chimera thereof; the first and second CFB specific target hybridization sequences are target hybridization sequences of (ID (d) and the CFB specific detection probe target hybridization sequence is SEQ ID NO: 25, or equivalent RNA or a DNA / RNA chimera thereof; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (a) and the target hybridization sequence of CFB-specific detection probe is SEQ ID No: 22 or SEQ ID No: 23, or an RNA equivalent or DNA / RNA chimera thereof; or the first and second target hybridization sequences CFB-specific are the target hybridization sequences of (ID) (c) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 23, or an RNA equivalent or a chimera of DNA / RNA thereof In some variations, the CFB-specific detection probe oligomer further comprises a detectable label such as, for example, u n fluorescent or chemiluminescent marker. In some embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
In certain embodiments of a kit for determining the presence or absence of GBS in a sample such as the above, the kit includes both the first and second combinations of amplification oligomers.
In another aspect, the present invention provides a kit for determining the presence or absence of GBS in a sample, wherein the kit comprises a combination of amplification oligomers comprising first and second amplification oligomers specific to S. / P capable of amplifying a target region of a target nucleic acid SIP to GBS. Particularly suitable first and second S / P specific amplification oligomers comprise, respectively, first (A) and second (B) target specific S / P hybridization sequences selected from (a) (A) SEQ ID N ° "3, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 4, or an equivalent of RNA or a DNA / RNA chimera thereof, here; and
(b) (A) SEQ ID No: 7, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof, and (B) SEQ ID No: 8, or an equivalent of RNA or a DNA / RNA chimera thereof.
In some variations, the kit further comprises a SIP-specific detection probe oligomer comprising an S / P-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second S / P specific amplification oligomers. In some of these embodiments, the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (a) and the PBS-specific detection probe target hybridization sequence is SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof. In other embodiments, the first and second SZP-specific target hybridization sequences are the target hybridization sequences of (b) and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: : 11, or an RNA equivalent or DNA / RNA chimera thereof. In some variations, the S / P-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In some embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the S / P specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations of a kit as above, the kit further comprises a second combination of amplification oligomers capable of amplifying a target region of a target nucleic acid CFB to GBS.
In another aspect, the present invention provides a kit for determining the presence or absence of GBS in a sample, wherein the kit comprises a combination of amplification oligomers comprising first and second amplification oligomers specific for CFB. capable of amplifying a target region of a CFB to GBS target nucleic acid. Particularly suitable first and second CFB-specific amplification oligomers comprise, respectively, first (A) and second (B) CFB-specific target hybridization sequences selected from (a) (A) a sequence which is about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID NO: 26, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 13 or SEQ ID No: 15, or an RNA equivalent or DNA / RNA chimera thereof;
(b) (A) SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof, and (B) SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof; and (d) (A) SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
In some embodiments, the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or DNA / RNA chimera thereof. this.
In some of these embodiments, the first CFB-specific target hybridization sequence of (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or DNA / RNA chimera of this one ; in some of these variations, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera of these.
In other embodiments, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof.
Particularly suitable first (A) and second (B) ACFB-specific target hybridization sequences of (a) include () (A) SEQ ID NO: 12, or an RNA equivalent or DNA / RNA chimera. thereof, and (B) SEQ ID NO: 13, or an RNA equivalent or DNA / RNA chimera thereof; (ii) (A) SEQ ID NO: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID No: 14, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and
(iv) (A) SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof, and (B) SEQ ID No: 15, or an equivalent of 'RNA or a DNA / RNA chimera thereof.
In some variations, the kit further comprises a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured for s 'hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB specific amplification oligomers. In some of these embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b) and the CFB-specific detection target hybridization sequence is SEQ ID NO: 24 , or an RNA equivalent or DNA / RNA chimera thereof; the first and second CFB-specific target hybridization sequences are target hybridization sequences of (d) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or an equivalent of RNA or a DNA / RNA chimera thereof; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a) and the CFB-specific detection probe target hybridization sequence is SEQ ID No: 22 or SEQ ID No: 23, or an RNA equivalent or DNA / RNA chimera thereof; or the first and second CFB specific target hybridization sequences are the target hybridization sequences of (c) and the CFB specific detection probe target hybridization sequence is SEQ ID NO: 23, or equivalent of RNA or a DNA / RNA chimera thereof. In some variations, the CFB-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In some embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher. In some variations of a kit as above, the kit further comprises a second combination of amplification oligomers capable of amplifying a target region of a target nucleic acid S / P to GBS.
In another aspect, the present invention provides a method for determining the presence or absence of GBS in a sample. In some embodiments, the method comprises (1) contacting a sample suspected of containing GBS having a first combination of amplification oligomers and / or a second combination of amplification oligomers, where ( D the first combination of amplification oligomers comprises first and second S / P specific amplification oligomers for amplifying a target region of a target nucleic acid S / P to GBS, where the first and second oligomers BE2019 / 5528 SIP-specific amplification sequences comprise, respectively, first (A) and second (B) target hybridization sequences specific to SIP selected from (a) (A) SEQ ID No. "3, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 4, or an RNA equivalent or a DNA / RNA chimera thereof; and (b) (A) SEQ ID NO: 7, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 8, or an equivalent of RNA or a DNA / RNA chimera. of it ; and (ID the second combination of amplification oligomers comprises first and second CFB-specific amplification oligomers for amplifying a target region of a CFB-to-GBS target nucleic acid, wherein the first and second specific amplification oligomers to CFB comprise, respectively, first (A ”) and second (B ') CFB specific target hybridization sequences selected from (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID No: 26, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 13 or SEQ ID No: 15, or an equivalent RNA or a DNA / RNA chimera thereof; (b) (A ") SEQ ID NO: 16, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A ") SEQ ID No: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (d) (A ") SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof;
(2) performing an in vitro nucleic acid amplification reaction, where any BE2019 / 5528 target nucleic acid S / P and / or CFB to GBS, if present in the sample, is used as template for generating at least one amplicon corresponding to the SIP and / or CFB region; and (3) detecting the presence or absence of at least one amplicon, thereby determining the presence or absence of GBS in the sample.
In some embodiments of a method as above, the method comprises contacting the sample with the first and second combinations of amplification oligomers. In some of these embodiments, the method is a multiplex method comprising contacting the sample with the first and second combinations of amplification oligomers in the same reaction mixture.
In some embodiments of a method as above, where the method comprises contacting the sample with the first combination of amplifying oligomers, the detecting step comprises contacting the reaction. of nucleic acid amplification in vitro with a SIP-specific detection probe oligomer comprising a SIP-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in an S7P amplicon amplifiable by the first and second S / P specific amplification oligomers. In some of these embodiments, the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (D (a) and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof. In other embodiments, the first and second S / P-specific target hybridization sequences are target hybridization sequences of (I) (b) and the S / P-specific detection probe target hybridization sequence is SEQ ID NO: 11, or an RNA equivalent or a DNA / RNA chimera In some variations, the S / P-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In some embodiments comprising a labeled probe oligomer detectably, the detectable label is a fluorescent label and the detectable probe oligomer. The specific S / P further comprises a non-fluorescent extinguisher.
In certain embodiments of a method as above, where the target CFB specific hybridization sequences are the target hybridization sequences of (ID) (a), the first CFB specific target hybridization sequence of (ID) ((a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a DNA / RNA chimera thereof.
this. In some of these embodiments, the first CFB-specific BE2019 / 5528 target hybridization sequence of (ID) (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or chimera. DNA / RNA thereof; in some of these variations, the first CFB-specific target hybridization sequence of (IT) (a) is SEQ ID NO: 12 or SEQ ID No: 14, or an RNA equivalent or a DNA chimera / RNA thereof. In other embodiments, where the CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (a), the first CFB-specific target hybridization sequence of (ID) (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof. Particularly suitable first (A ") and second (B ') aCFB specific target hybridization sequences of (ID) (a) include (1) (A) SEQ ID NO: 12, or an RNA equivalent or an DNA / RNA chimera thereof, and (B) SEQ ID NO: 13, or an RNA equivalent or DNA / RNA chimera thereof; (ii) (A) SEQ ID N °: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera of the latter; (iii) (A ") SEQ ID NO: 14, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and (iv) (A ") SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof.
In some embodiments of a method as above, where the method comprises contacting the sample with the second combination of amplifying oligomers, the detecting step comprises contacting the reaction. of nucleic acid amplification in vitro with a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB specific amplification oligomers. In some of these embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID (b) and the BE2019 / 5528 CFB-specific detection target hybridization sequence is SEQ ID No: 24, or an RNA equivalent or DNA / RNA chimera thereof; the first and second CFB-specific target hybridization sequences are target hybridization sequences of (ID) (d) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or an RNA equivalent or DNA / RNA chimera thereof; the first and second target hybridization sequences specific to CFB are the target hybridization sequences of (ID) (a) and the target hybridization sequence of CFB specific detection probe is SEQ ID NO: 22 or SEQ ID No: 23, or equivalent of RNA or a DNA / RNA construct thereof; or the first and second CFB-specific target hybridization sequences are the sequences of target hybridization of (ID) (c) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
In some variations, the CFB-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label.
In some embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
In some variations of a method for determining the presence or absence of GBS in a sample as above, the detection step is performed in real time.
In some variations of a method for determining the presence or absence of GBS in a sample as above, the in vitro nucleic acid amplification reaction is a PCR amplification reaction (e.g., a real-time PCR amplification reaction). In some embodiments of a method as above, where the method comprises contacting the sample with the first and second combinations of amplification oligomers (eg, a multiplex method), step detection comprises contacting the in vitro nucleic acid amplification reaction with (i) an S / P-specific detection probe oligomer, comprising an S7P-specific detection probe target hybridization sequence which is about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in an S / P amplicon amplicon by the first and second S / P specific amplification oligomers, and (ii) a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence that is from about 15 to about 35 nucleotides in length and configured to hybridize to a target sequence present in a CFB amplicon amp reliable by the first and second CFB-specific amplification oligomers, where each of the S / P and CFB-specific BE2019 / 5528 detection probe oligomers comprises a fluorescent label and a non-fluorescent quencher. In some of these embodiments, the in vitro nucleic acid amplification reaction is a real-time PCR amplification reaction.
In another aspect, the present invention provides a method for determining the presence or absence of GBS in a sample, wherein the method comprises (1) contacting a sample suspected of containing GBS with a combination of Amplification oligomers comprising first and second S / P specific amplification oligomers for amplifying a target region of an S / P target nucleic acid to GBS, wherein the first and second S / P specific amplification oligomers P comprise, respectively, first (A) and second (B) target hybridization sequences specific to SZP selected from (a) (A) SEQ ID NO: 3, or an RNA equivalent or a DNA chimera / RNA thereof, and (B) SEQ ID NO: 4, or an RNA equivalent or DNA / RNA chimera thereof; and (b) (A) SEQ ID NO: 7, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 8, or an equivalent of RNA or a DNA / RNA chimera thereof; (2) performing an in vitro nucleic acid amplification reaction, where any S / P to GBS target nucleic acid, if present in the sample, is used as a template to generate at least one amplicon corresponding to the S / P region; and (3) detecting the presence or absence of the amplicon, thereby determining the presence or absence of GBS in the sample.
In some variations, the detection step comprises contacting the in vitro nucleic acid amplification reaction with an S / P-specific detection probe oligomer, comprising a detection probe target hybridization sequence. specific to S / P which is about 15 to about 35 nucleotides in length and which is configured to hybridize to a target - sequence present in an S / P amplicon amplifiable by the first and second S-specific amplification oligomers / P. In some of these embodiments, the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (a) and the SIP-specific detection probe target hybridization sequence is SEQ ID No: 9, or an RNA equivalent or DNA / RNA chimera thereof. In other embodiments, the first and second S / P-specific target hybridization sequences are the target hybridization sequences of
(b) and the SIP-specific detection probe target hybridization sequence is SEQ ID NO: 11, or BE2019 / 5528 an RNA equivalent or DNA / RNA chimera thereof.
In some variations, the S / P-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label.
In certain embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the S / P specific detection probe oligomer further comprises a non-fluorescent quencher.
In some variants, the detection step is performed in real time.
In some variations, the in vitro nucleic acid amplification reaction is a PCR amplification reaction (for example, a real-time PCR amplification reaction). In some embodiments, the method further comprises contacting the sample with a second combination of amplification oligomers comprising first and second CFB-specific amplification oligomers to amplify a target region of an acid. CFB to GBS target nucleic acid, where, in the amplification step, any CFB to GBS target nucleic acid, if present in the sample, is used as a template to generate an amplicon corresponding to the CFB target region, and wherein the detecting step comprises detecting the presence or absence of the amplicon corresponding to the target region CFB.
In another aspect, the present invention provides a method for determining the presence or absence of GBS in a sample, wherein the method comprises (1) contacting a sample suspected of containing GBS with a combination of Amplification oligomers comprising first and second CFB-specific amplification oligomers for amplifying a target region of a CFB-to-GBS target nucleic acid, wherein the first and second CFB-specific amplification oligomers comprise, respectively, first (A) and second (B) target hybridization sequences specific to CFB selected from (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID NO: 26, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 13 or SEQ ID No: 15, or an RNA equivalent or a DNA chimera / RNA thereof; (b) (A) SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID NO: 18, or an RNA equivalent or a DNA / RNA chimera thereof, and
(B) SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera of thatBE2019 / 5528 ci; and (d) (A) SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof;
(2) performing an in vitro nucleic acid amplification reaction, where any CFB to GBS target nucleic acid, if present in the sample, is used as a template to generate at least one amplicon corresponding to the CFB region; and
(3) detecting the presence or absence of the amplicon, thereby determining the presence or absence of GBS in the sample.
In some embodiments, the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or DNA / RNA chimera thereof. this.
In some of these embodiments, the first CFB-specific target hybridization sequence of (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or DNA / RNA chimera of this one ; in some of these variations, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or DNA / RNA chimera of these.
In other embodiments, the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof.
Particularly suitable first (A) and second (B) ACFB-specific target hybridization sequences of (a) include (Ï (A) SEQ ID NO: 12, or an RNA equivalent or a DNA / RNA chimera. thereof, and (B) SEQ ID NO: 13, or an RNA equivalent or DNA / RNA chimera thereof; (ii) (A) SEQ ID NO: 12, or a RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or RNA equivalent or DNA / RNA chimera thereof; (iii) (A) SEQ ID NO: 14, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a chimera d DNA / RNA thereof; and (iv) (A) SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and
(B) SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof BE2019 / 5528 ci.
In some variations, the detection step comprises contacting the in vitro nucleic acid amplification reaction with a CFB-specific detection probe target hybridization sequence that is from about 15 to about. 35 nucleotides and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB specific amplification oligomers.
In some of these embodiments, the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b) and the CFB-specific detection target hybridization sequence is SEQ ID NO: 24 , or an RNA equivalent or DNA / RNA chimera thereof; the first and second CFB-specific target hybridization sequences are target hybridization sequences of (d) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or an equivalent of RNA or a DNA / RNA chimera thereof; the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a) and the CFB-specific detection probe target hybridization sequence is SEQ ID No: 22 or SEQ ID No: 23, or an RNA equivalent or DNA / RNA chimera thereof; or the first and second CFB specific target hybridization sequences are the target hybridization sequences of (c) and the CFB specific detection probe target hybridization sequence is SEQ ID NO: 23, or equivalent of RNA or a DNA / RNA chimera thereof.
In some variations, the CFB-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label.
In some embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
In some variants, the detection step - is performed in real time.
In some variations, the in vitro nucleic acid amplification reaction is a PCR amplification reaction (for example, a real-time PCR amplification reaction). In some embodiments, the method further comprises contacting the sample with a second combination of amplification oligomers comprising first and second SP specific amplification oligomers to amplify a target region of an acid. S / P to GBS target nucleic acid, where, at the amplification step, any S / P to GBS target nucleic acid, if present in the sample, is used as a template to generate an amplicon corresponding to the region S / P target, and wherein the detecting step comprises detecting the presence or absence of the amplicon corresponding to the S / P target region.
In certain embodiments of a method for determining the presence or absence of GBS in a sample, the method determines the presence or absence of one of GBS serotypes Ia, Ib, Ic, II, III, IV, V, VI, VII, VIII and IX.
In some of these embodiments, the method further determines the presence or absence of a non-BE2019 / 5528 hemolytic strain of GBS.
In another aspect, the present invention provides a detection probe oligomer. In some embodiments, the detection probe oligomer is a SIP-specific detection probe oligomer comprising a S / P-specific detection probe target hybridization sequence that is from about 15 to about 35 in length. nucleotides and which is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by a first combination of amplification oligomers which comprises first and second S / P specific amplification oligomers capable of amplifying a target region of a GBS S / P target nucleic acid, the first and second S / P specific amplification oligomers respectively comprising a first (A) and a second (B) S / specific target hybridization sequences P selected from the group consisting of (a) (A) SEQ ID NO: "3, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 4, or an RNA equivalent or a DNA / RNA chimera thereof; and (b) (A) SEQ ID NO: 7, or an equivalent slow RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 8, or an equivalent of RNA or a DNA / RNA chimera thereof. In certain embodiments of a SIP-specific detection probe oligomer as above, the S / P-specific detection probe target hybridization sequence is selected from (a) SEQ ID NO: 9, or an RNA equivalent or a DNA / RNA chimera thereof, and (b) SEQ ID NO: 11, or an RNA equivalent or a DNA / RNA chimera thereof. In some variations, the S / P-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label. In certain embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the S / P specific detection probe oligomer further comprises a non-fluorescent quencher.
In other embodiments, the detection probe oligomer is a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence that is from about 15 to about nucleotides in length. and which is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by a second combination of amplification oligomers which comprises first and second CFB-specific amplification oligomers capable of BE2019 / 5528 of amplifying a target region of a CFB to GBS target nucleic acid, the first and second CFB specific amplification oligomers respectively comprising a first (A) and a second (B) CFB specific target hybridization sequences selected from (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID NO: 26, or an RNA equivalent or DNA / RNA chimera thereof, and (B ') SEQ ID N °: 13 or SEQ ID No .: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; (b) (A) SEQ ID No: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A ") SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (d) (A ") SEQ ID NO: 20, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ) SEQ ID NO: 21, or an RNA equivalent or DNA / RNA chimera thereof.
In certain embodiments of a CFB-specific detection probe oligomer as above, the CFB-specific detection probe target hybridization sequence is selected from (a) SEQ ID NO: 24, or equivalent. of RNA or a DNA / RNA chimera thereof, (b) SEQ ID NO: 25, or an RNA equivalent or a DNA / RNA chimera thereof, (c) SEQ ID NO: 22, or an equivalent of RNA or a DNA / RNA chimera thereof, and (d) SEQ ID NO: 23, or an equivalent of RNA or a DNA / RNA chimera of this one.
In some variations, the CFB-specific detection probe oligomer further comprises a detectable label such as, for example, a fluorescent or chemiluminescent label.
In some embodiments comprising a detectably labeled probe oligomer, the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
In another aspect, the present invention provides a composition comprising an SZP-specific detection probe oligomer and a CFB-specific detection probe oligomer as above.
In another aspect, the present invention provides an aqueous formulation for GBS nucleic acid detection comprising (1) an S7P-specific detection probe oligomer and / or a CFB-specific detection probe oligomer such as above and (2) an organic buffer. In some embodiments, the aqueous formulation further comprises at least one component selected from a surfactant (eg, polyethylene glycol mono [4- (1,1,3,3-tetramethylbutyl) phenyl] ether, polysorbate 20, or a combination thereof), a DNA polymerase enzyme, a reverse transcriptase enzyme, at least one amplifying oligomer and a blowing agent (eg, trehalose, raffinose or a combination thereof). In some variations comprising a surfactant, the surfactant is a non-linear surfactant, for example, polysorbate 20. In some embodiments, the aqueous formulation contains an inorganic salt at a concentration of 4 mM or less. According to a related aspect, the present invention provides a reaction mixture for the detection of GBS comprising an aqueous formulation as above.
In another aspect, the present invention provides a dried formulation for the detection of GBS nucleic acid comprising (1) an S7P-specific detection probe oligomer and / or a CFB-specific detection probe oligomer as above. above and (2) a blowing agent. In some embodiments, the blowing agent is trehalose, raffinose, or a combination thereof. In some embodiments, the dried formulation further comprises at least one component selected from an inorganic salt, a DNA polymerase enzyme, a reverse transcriptase enzyme, at least one amplifying oligomer, and a surfactant (eg, polyethylene glycol mono [4- (1,1,3,3-tetramethylbutyl) phenyl] ether, polysorbate 20 or a combination thereof). In some embodiments further comprising an inorganic salt, the percentage by weight of the inorganic salt relative to the weight of the dried formulation is less than or equal to 0.249%. In some variations comprising a surfactant, the surfactant is a non-linear surfactant, for example, polysorbate 20. In some variations, the dried formulation is a lyophilized formulation. In a related aspect, the present invention provides a reaction mixture for the detection of GBS, wherein the reaction mixture is reconstituted with water and an organic buffer from a dried formulation as above. In some embodiments, the reaction mixture contains an inorganic salt, for example, magnesium, potassium or sodium; in some of these variations, the concentration of the inorganic salt is less than or equal to 4 mM.
These and other aspects of the invention will become apparent with reference to the following detailed description of the invention and the accompanying drawings.
DEFINITIONS Unless defined otherwise, all technical and scientific terms used in the present invention have the same meaning as that commonly understood by an ordinary specialist in the field to which the methods and compositions described refer.
General definitions can be found in technical works relating to the field of molecular biology, for example, Dictionary of Microbiology and Molecular Biology, 2nd edition. (Singleton et al., 1994, John Wiley & Sons, New York, NY) or The Harper Collins Dictionary of Biology (Hale & Marham, 1991, Harper Perennial, New York, NY). As used in the present invention, the following terms and expressions have their meanings ascribed to them, unless otherwise indicated.
The terms "a", "a", "the", "the" "the" and "the" include plural referents, unless the context clearly indicates otherwise. For example, "a nucleic acid" as used in the present invention is intended to represent one or more nucleic acids. Thus, the terms "one" or "one", "one or more" and "at least one" can be used interchangeably in the present invention.
It will be appreciated that the term "about" is understood in relation to the data of temperatures, concentrations, time, etc. in the present invention, so that the deviations within the scope of the teachings of the present invention are slight and negligible.
In general, the term "about" denotes negligible change in an amount of a component of a composition which has no significant effect on the effectiveness or stability of the composition. All ranges should be interpreted as including endpoints in the absence of express exclusions such as "not including endpoints", so, for example, "between 10 and 15" includes values 10 and 15. In addition, the use of “include”, “includes”, “comprising”, “contain”, “contains”, “containing”, “include”, “includes” and “comprising” is not intended to be restrictive. It should be understood that the above general description and the detailed description are only examples and explanations and are not intended to limit the teachings. If any material incorporated by reference is inconsistent with the express content of the present invention, the express content shall prevail.
Unless specifically indicated, in the description, the embodiments in any description which cites "comprising" various components are also considered as "consisting of" or "consisting essentially of" the cited components; the embodiments in the description which cite "consisting of" various components are also considered as "comprising" or "consisting essentially of" the cited components;
and the embodiments in the description which cite "consisting essentially of" BE2019 / 5528 various components are also considered as "consisting of" the cited components or "comprising" them (this interchangeability does not apply to the use of these terms in the claims). "Consisting essentially of" means that the component (s), composition (s) or additional step (s) which do not materially change the fundamental and novel characteristics of the compositions and methods described in the present invention may be included. in these compositions or methods. These characteristics include the ability to detect a group B streptococcal (GBS) nucleic acid sequence present in a sample with a specificity that distinguishes GBS nucleic acid from other known pathogens, possibly at a sensitivity that allows detect the bacteria present in a sample at a concentration of about 100 CFU / ml and, optionally, within about 60 minutes and / or within about 40 cycles from the start of an amplification reaction when a cycled amplification reaction is used.
"Sample" includes any sample which may contain "GBS" or components thereof, such as nucleic acids or fragments of nucleic acids. Samples include "biological samples", which include any tissue or material derived from a living or dead human being that may contain GBS or target nucleic acid derived therefrom, including, for example, samples of '' vaginal swab, cervical brush samples, respiratory tissues or exudates such as bronchoscopy, bronchoalveolar lavage (BAL) or lung biopsy, sputum, saliva, peripheral blood, plasma, serum, lymph nodes, gastrointestinal tissues, feces, urine, semen or other fluids or bodily matter. The biological sample can be processed to physically or mechanically disrupt tissue or cell structure, thereby releasing intracellular components into a solution which may further contain enzymes, buffers, salts, detergents and the like, which are used for the preparation. of a biological sample for analysis using standard methods. Additionally, samples may include processed samples, such as those obtained by passing samples through or through a filtration device, or after centrifugation, or by adhering to a medium, matrix or support.
"Nucleic acid" and "polynucleotide" denote a multimeric compound comprising nucleosides or nucleoside analogs which have nitrogenous heterocyclic bases or base analogs linked together to form a polynucleotide, comprising RNA, conventional DNA, mixed RNA-DNA and polymers which are analogues thereof. The nucleic acid "backbone" may be made up of a variety of bonds, including one or more of sugar-phosphodiester bonds, BE2019 / 5528 peptide-nucleic acid bonds ("peptide nucleic acids" or PNAs; PCT publication no. WO 95/32305), phosphorothioate bonds, methylphosphonate bonds or combinations thereof.
The sugar moieties of a nucleic acid can be ribose, deoxyribose or similar compounds with substitutions, for example, 2 'methoxy or 2' halide substitutions.
Nitrogenous bases can be conventional bases (A, G, C, T, U), analogs thereof (eg, inosine or the like; see Nucleic Acids 5-36, Adams et al., Ed, 11th edition, 1992), derivatives of purines or pyrimidines (for example, N * -methyl deoxyguanosine, deaza- or aza-purines, lesdeaza- or aza-pyrimidines, pyrimidine bases containing substituent groups in position 5 or 6, purine bases having a substituent in positions 2, 6 or 8, 2-amino-6-methylaminopurine, O ° -methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazine -pyrimidines and O * -alkyl-pyrimidines; U.S. Patent No. 5,378,825 and PCT Publication No. WO 93/13121). The nucleic acids can include at least one "abasic" residue, where the backbone does not include a nitrogenous base for the position (s) of the polymer (US Patent No. 5,585,481). A nucleic acid may include only conventional sugars, bases and RNA or DNA bonds, or may include both conventional components and substitutions (eg, conventional bases having 2'-methoxy, or polymers containing both conventional bases and at least one base analogue). Nucleic acid comprises "blocked nucleic acid" (LNA), an analogue containing at least one nucleotide monomer of LNA having a bicyclic furanose unit blocked in an RNA mimicking the conformation of sugar, which improves hybridization affinity. to complementary RNA and DNA sequences (Vester and Wengel, 2004) Biochemistry 43 (42): 13233-
41). Embodiments of oligomers which may affect the stability of a hybridization complex include oligomers of PNA, oligomers comprising RNA substituted with 2'-methoxy or 2'-fluoro, or oligomers which affect the overall charge, charge density, or steric associations of a hybridization complex, including oligomers that contain charged bonds (eg, phosphorothioates) or neutral groups (eg, methylphosphonates). 5-Methylcytosines can be used in conjunction with any of the foregoing backbones / sugars / linkages, including RNA or DNA backbones (or mixtures thereof), unless otherwise specified.
It is understood that with respect to ranges of the length of an oligonucleotide, amplicon or other nucleic acid, the range includes all integers (for example, a length of 19 to 25 contiguous nucleotides includes 19, 20, 21, 22, 23, 24 and 25).
A "nucleotide" as used in the present invention is a subunit of a BE2019 / 5528 nucleic acid consisting of a phosphate group, a 5-carbon sugar and a nitrogenous base (also referred to in the art. present invention "nucleobase"). The 5-carbon sugar found in RNA is ribose. In DNA, the 5-carbon sugar is 2'-deoxyribose. The term also includes analogs of subunits, such as a methoxy group at the 2 'position of ribose (also referred to herein as "2'-O-Me" or "2'-methoxy").
By "RNA and DNA equivalents" are meant RNA and DNA molecules exhibiting essentially the same properties of complementary base pair hybridization. RNA and DNA equivalents have different sugar moieties (i.e. Ribose versus deoxyribose) and may differ in the presence of uracil in RNA and thymine in DNA. The differences between equivalent RNA and DNA do not contribute to differences in homology because the equivalents exhibit the same degree of complementarity as a particular sequence. By "DNA / RNA chimera" is meant a nucleic acid comprising both DNA and RNA nucleotides. Unless the context clearly dictates otherwise, reference to a nucleic acid to GBS includes the RNA and DNA equivalents to GBS and DNA / RNA chimeras thereof.
As used in the present invention, a "target nucleic acid" is a nucleic acid comprising a target sequence to be amplified. Target nucleic acids can be DNA or RNA and can be single stranded or double stranded. The target nucleic acid may include sequences other than the target sequence, which may not be amplified.
The term "target sequence" as used in the present invention refers to the particular nucleotide sequence of the target nucleic acid which is to be amplified and / or detected. The "target sequence" includes complexing sequences to which oligonucleotides (eg, initiator oligonucleotides and / or promoter oligonucleotides) complex during amplification processes (eg, PCR, TMA). When the target nucleic acid is originally single-stranded, the term "target sequence" will also refer to the sequence complementary to the "target sequence" as present in the target nucleic acid. When the target nucleic acid is originally double-stranded, the term "target sequence" refers to both the sense (+) and antisense (-) strands.
The "target hybridization sequence" or "target specific sequence" is used in the present invention to refer to the part of an oligomer which is configured to hybridize to a target nucleic acid sequence. Preferably, the target hybridization sequences are configured to specifically hybridize to a target nucleic acid sequence. Target hybridization sequences can be 100% complementary to the part of the target sequence with which they are configured to hybridize, but not necessarily. Target hybridization sequences can also include nucleotide residues inserted, deleted and / or substituted with respect to a target sequence. Less than 100% complementarity of a target hybridization sequence to a target sequence can occur, for example, when the target nucleic acid consists of a plurality of strains within a species, as would be the case. for an oligomer configured to hybridize to various GBS serotypes. It is understood that there are other reasons for configuring a target hybridization sequence to exhibit less than 100% complementarity to a target nucleic acid.
The term "targeting a sequence", as used in the present invention in reference to a region of nucleic acid at GBS, refers to a process by which an oligonucleotide hybridizes to a target sequence in a manner. which allows amplification and detection as described in the present invention. In a preferred embodiment, the oligonucleotide is complementary to the targeted GBS nucleic acid sequence and does not contain mismatches. In another preferred embodiment, the oligonucleotide is complementary but contains 1, 2, 3, 4 or 5 mismatches with the targeted GBS nucleic acid sequence. Preferably, the oligomer specifically hybridizes to the target sequence.
The term "configured for" refers to an actual arrangement of the pattern of polynucleotide sequences of a referenced target oligonucleotide hybridization sequence. For example, amplification oligomers configured to generate a specified amplicon from a target sequence have polynucleotide sequences that hybridize to the target sequence and can be used in an amplification reaction to generate the amplicon. Also by way of example, oligonucleotides which are configured to specifically hybridize to a target sequence include a polynucleotide sequence which specifically hybridize to the referenced sequence under stringent hybridization conditions.
The term "configured to specifically hybridize" as used in the present invention means that the region hybridizes to the target hybridization region of an amplifying oligonucleotide, a detection probe, or the like. oligonucleotide is designed to include a polynucleotide sequence which could target a sequence of the referenced GBS target region. Such an oligonucleotide is not limited to this targeting sequence only, but is rather useful as a composition, in a kit, or in a method of targeting a target nucleic acid to GBS. The oligonucleotide is designed to function BE2019 / 5528 as a component of an assay for amplification and detection of GBS from a sample, and is therefore designed to target GBS in the presence of nucleic acids other than commonly found in test samples. "Specifically hybridizes to" does not mean exclusively hybridizes to, as a low level of hybridization to non-target nucleic acids can occur, as is understood in the art. Instead, "to hybridize specifically to" means that the oligonucleotide is configured to function in an assay to primarily hybridize the target, so that accurate detection of the target nucleic acid in a sample can be made. determined.
The term "region" as used in the present invention refers to a part of a nucleic acid, said part being smaller than the whole nucleic acid. For example, when the reference nucleic acid is an oligonucleotide promoter-primer, the term "region" can be used to refer to the smaller portion of the promoter. Likewise, and by way of example only, when the nucleic acid is a GBS target nucleic acid, the term "region" can be used to denote a smaller area of the nucleic acid, the smaller area being targeted. with at least one oligonucleotide of the present invention. As another non-limiting example, when the reference nucleic acid is an amplicon, the term region can be used to refer to the smaller nucleotide sequence identified for hybridization by the target hybridization sequence of a probe.
"Oligomer," "oligonucleotide" or "oligo" refers to nucleic acid generally less than 1,000 nucleotides (nt), including those whose size range has a lower limit of about 2 to 5 nt and an upper limit of about 500 to 900 nt. Some particular embodiments are oligomers whose size range has a lower limit of about 5 to 15, 16, 17, 18, 19 or 20 nt and an upper limit of about 50 to 600 nt, and others Particular embodiments are in a size range having a lower limit of about 10 to 20 nt and an upper limit of about 22 to 100 nt. Oligomers can be purified from natural sources, but can be synthesized using any well known enzymatic or chemical process. The term oligonucleotide does not denote any particular function of the reagent; rather, it is used generically to cover all of the reagents described in the present invention. An oligonucleotide can perform various functions. For example, it can serve as a primer if it is specific and capable of hybridizing to a complementary strand and can further be extended in the presence of a nucleic acid polymerase; it can function as a primer and provide a promoter if it contains a sequence recognized by an RNA polymerase and allows transcription (eg, a T7 primer); and it may function to detect a target nucleic acid if it is capable of hybridizing to the target nucleic acid, or an amplicon thereof, and further provides a detectable moiety (e.g., an ester compound BE2019 / 5528 acridinium). Oligomers may be referred to by a functional name (eg, capture probe, primer, or promoter-primer), but those skilled in the art will understand that these terms refer to oligomers.
As used in the present invention, an oligonucleotide "substantially corresponding to" a specified reference nucleic acid sequence means that the oligonucleotide is sufficiently similar to the reference nucleic acid sequence that the oligonucleotide exhibits properties. hybridizations similar to the reference nucleic acid sequence in that it would hybridize to the same target nucleic acid sequence under stringent hybridization conditions. One skilled in the art will understand that "substantially corresponding oligonucleotides" can vary from a reference sequence and hybridize to the same target nucleic acid sequence. It is also understood that a first nucleic acid corresponding to a second nucleic acid comprises the RNA or DNA equivalent thereof, as well as DNA / RNA chimeras thereof, and includes the complements of it, unless the context clearly indicates otherwise. This variation in nucleic acid can be expressed as a percentage of identical bases in the sequence or as a percentage of perfectly complementary bases between the probe or primer and its target sequence; thus, in certain embodiments, an oligonucleotide “substantially” corresponds to a reference nucleic acid sequence if these percentages of basic identity or complementarity are between 100% and about 80%, preferably between 100% and about 85%, or more preferably between 100% and about 90% or between 100% and about 95%. This nucleic acid variation can also be indicated in terms of the number of substitutions in a nucleic acid sequence relative to a reference sequence, or the number of mismatches in a sequence relative to a target sequence; thus, in some embodiments, an oligonucleotide "substantially matches" a reference nucleic acid sequence if that number of nucleobase substitutions or mismatches is up to four, preferably up to three, or more preferably up to. 'to two or up to at least one substitution or at least one mismatch (i.e. zero to four, preferably zero to three, or more preferably zero to two or zero to one, inclusive ). Likewise, a region of an amplified nucleic acid or nucleic acid can be considered in the present invention as corresponding to a reference nucleic acid sequence. One skilled in the art will understand the various modifications to hybridization conditions that might be required at different percentages of complementarity to allow hybridization to a specific target sequence without causing an unacceptable level of non-specific hybridization.
As used in the present invention, the expression "or its complement, or uRE2019 / 5528 RNA equivalent or a DNA / RNA chimera thereof", with reference to a sequence of DNA, comprises (in addition to the DNA sequence referenced) the complement of the DNA sequence, an RNA equivalent of the referenced DNA sequence, an RNA equivalent of the complement of the referenced DNA sequence , a DNA / RNA chimera of the referenced DNA sequence and a DNA / RNA chimera of the complement of the referenced DNA sequence. Likewise, the expression "or its complement, or a DNA equivalent or a DNA / RNA chimera thereof", in reference to an RNA sequence, includes (in addition to the referenced RNA sequence) the complement of the referenced RNA sequence, a DNA equivalent of the referenced RNA sequence, a DNA equivalent of the complement of the referenced RNA sequence, a DNA / RNA chimera of the referenced RNA sequence and a DNA / RNA chimera of the complement of the referenced RNA sequence.
An "amplification oligonucleotide" or an "amplification oligomer" is an oligonucleotide which hybridizes to a target nucleic acid, or its complement, and participates in a nucleic acid amplification reaction, for example, by serving primer or and promoter primer. The particular amplification oligomers contain at least about 10 contiguous bases, and optionally at least 11, 12, 13, 14, 15, 16, 17, 18, 19 or contiguous bases, which are complementary to a region of the sequence of target nucleic acids or its complementary strand. Contiguous bases can be at least about 80%, at least about 90%, or completely complementary to the target sequence to which the amplification oligomer binds. It will be understood by those skilled in the art that the cited ranges include all integers and rationals within the range (eg, 92% or 98.377%). The particular amplification oligomers are from about 10 to about 60 bases in length and may optionally include modified nucleotides.
A "primer" is an oligomer which hybridizes to a template nucleic acid and has a 3 'end which is extended by polymerization. A primer can optionally be modified, for example, by including a 5 'region not complementary to the target sequence. Such modification may include functional additions, such as tags, promoters, or other sequences without a specific target, used or useful to manipulate or amplify the target primer or oligonucleotide.
In the context of transcription-mediated amplification, a primer modified with a 5 'promoter sequence is referred to herein as a "promoter-primer".
One skilled in the art of molecular biology or biochemistry will understand that an oligomer capable of functioning as a primer can be modified to include a BE2019 / 5528 5 'promoter sequence, then function as a promoter-primer, and likewise, any promoter-primer can serve as a primer with or without its 5 'promoter sequence. A promoter-primer modified to incorporate a blocked 3 'end is referred to herein as a "promoter provider" which is capable of hybridizing to a target nucleic acid and providing an upstream promoter sequence which serves to initiate transcription. , but does not provide a primer for the extension of oligo.
The "sequence without a specific target" or the "hybridization sequence without a target", as used in the present invention, refers to a region of an oligomer sequence, said region not hybridizing in a stable manner. to a target sequence under standard hybridization conditions.
Oligomers having sequences without a specific target include, but are not limited to, promoter-primers and molecular beacons. "Nucleic acid amplification" refers to any in vitro procedure which produces multiple copies of a target nucleic acid sequence, or its complementary sequence, or fragments thereof (i.e. say an amplified sequence containing less than the full target nucleic acid). Examples of nucleic acid amplification procedures include methods associated with transcription, such as transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), and the like (e.g. example, U.S. Patent Nos. 5,399,491, 5,554,516, 5,437,990, 5,130,238, 4,868,105, and 5,124,246), replicase-mediated amplification (eg, U.S. Patent No. 4,786,600), polymerase chain reaction (PCR) (eg , U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159), Ligase Chain Reaction (LCR) (eg, EP Patent No. 0320308), Helicase Dependent Amplification (eg, U.S. Patent No. 7,282,328) and Strand Displacement Amplification (SDA) (eg, U.S. Patent No. 5,422,252). The amplification can be linear or exponential.
Replicase-mediated amplification uses self-replicating RNA molecules and a replicase such as QB-replicase.
PCR amplification uses DNA polymerase, primers, and thermal cycling steps to synthesize multiple copies of the two complementary strands of DNA or cDNA.
LCR amplification uses at least four distinct oligonucleotides to amplify a target and its complementary strand using multiple rounds of hybridization, ligation, and denaturation.
Helicase-dependent amplification uses a helicase to separate the two strands of a DNA duplex generating single-stranded templates, followed by the hybridization of sequence-specific primers that hybridize to the templates and extension by DNA polymerase to amplify the target sequence.
SDA uses a primer containing a recognition site for a restriction endonuclease that nicks a strand of a hemimodified BE2019 / 5528 DNA duplex that includes the target sequence, followed by amplification in a series of extension steps. primer and strand displacement. Particular embodiments use PCR or TMA, but it will be obvious to those skilled in the art that the oligomers described in the present invention can be readily used as primers in other amplification methods.
Amplification associated with transcription uses DNA polymerase, RNA polymerase, deoxyribonucleoside triphosphates, ribonucleoside triphosphates, an oligonucleotide containing a promoter, and may optionally include other oligonucleotides, to ultimately produce multiple RNA transcripts at from a nucleic acid template (described in detail in, e.g., U.S. Patent Nos. 5,399,491 and 5,554,516 to Kacian et al., U.S. Patent No. 5,437,990 to Burg et al; PCT Publication Nos. WO 88 / 01302 and WO 88/10315 (Gingeras et al.); U.S. Patent No. 5,130,238 to Malek et al., U.S. Patent Nos. 4,868,105 and 5,124,246 to Urdea et al, PCT Publication No. WO 94/03472 (McDonough et al.); and PCT Publication No. WO 95/03430 (Ryder et al.)). Methods which utilize TMA are described in detail previously (eg, U.S. Patent Nos. 5,399,491 and 5,554,516).
In cyclic amplification methods that detect amplicons in real time, the term "threshold cycle" (Ct) is a measure of the time to emergence of a signal associated with target amplification and is typically 10 x l. standard deviation of the normalized reporter signal. Once an amplification reaches the "threshold cycle", it is generally considered that there is a positive amplification product of a sequence to which the probe binds. The identity of the amplification product can then be determined by methods known to those skilled in the art, such as gel electrophoresis, nucleic acid sequencing, and other similar analytical procedures.
By "amplicon" or "amplification product" is meant a nucleic acid molecule generated in a nucleic acid amplification reaction and which is derived from a target nucleic acid. An amplicon or amplification product contains a target nucleic acid sequence which may be of the same or opposite sense to the target nucleic acid.
As used in the present invention, the term "relative fluorescence unit" ("RFU") is a unit of measurement of fluorescence intensity. The RFU varies depending on the characteristics of the detection means used for the measurement and can be used as a measure to compare the relative intensities of samples and controls.
"Detection probe oligomer," "detection probe" or "probe" BE2019 / 5528 refers to an oligomer which specifically hybridizes to a target sequence, comprising an amplified sequence, under conditions which promote hybridization. nucleic acid, for the detection of the target nucleic acid. Detection can be direct (eg, the probe hybridized directly to the target) or indirect (eg, a probe is hybridized to an intermediate structure that connects the probe to the target). Detection probes can be DNA, RNA, analogs thereof, or combinations thereof (eg, DNA / RNA chimeras), and they may or may not be labeled. Detection probes may further include other backbones such as, for example, 2'-O-methyl bonds. The target sequence of a probe generally refers to the specific sequence within a sequence larger than the hybrid probe specifically. A detection probe can comprise at least one sequence specific to a target and at least one sequence without a specific target. Such non-target specific sequences can include sequences which will confer a desired secondary or tertiary structure, such as a hairpin structure, which can be used to facilitate detection and / or amplification (see, e.g. , U.S. Patent Nos. 5,118,801, 5,312,728, 6,835,542 and 6,849,412). The probes of a defined sequence can be produced by techniques known to those skilled in the art, for example by chemical synthesis, and by expression in vitro or in vivo from recombinant nucleic acid molecules.
By "hybridization" or "hybridize" is meant the ability of two completely or partially complementary nucleic acid strands to come together under specified hybridization test conditions in a parallel or antiparallel orientation to form a stable structure comprising a region. double stranded. The two constituent strands of this double-stranded structure, sometimes called a hybrid, are held together by hydrogen bonds. Although these hydrogen bonds most often form between nucleotides containing the bases adenine and thymine or uracil (A and T or U) or cytosine and guanine (C and G) on strands of acid single nucleic acid, a base pairing can also form between bases which do not belong to these "canonical" pairs. Non-canonical base pairing is well known in the art. See, e.g., RLP Adams et al. The Biochemistry of the Nucleic Acids (11th Edition, 1992).
By "hybridize preferentially" is meant that under stringent hybridization conditions, an amplification or detection probe oligomer can hybridize to its target nucleic acid to form a target hybrid of stable oligomers, but not a number. sufficient non-target hybrids of stable oligomers. Amplification and detection oligomers that preferentially hybridize to a target nucleic acid are useful for amplifying and detecting target nucleic acids, but not non-target organisms, particularly closely related phylogenetically organisms. Thus, BE2019 / 5528 the oligomer hybridizes to the target nucleic acid to an extent sufficiently greater than that of the non-target nucleic acid to allow the specialist in the field to amplify and / or accurately detect the presence ( or the absence) of nucleic acid derived from the specified target, if any. In general, reducing the degree of complementarity between an oligonucleotide sequence and its target sequence will decrease the degree or rate of hybridization of the oligonucleotide to its target region. However, the inclusion of at least one nucleoside or at least one non-complementary nucleobase may facilitate the ability of an oligonucleotide to discriminate against non-target organisms.
Preferential hybridization can be measured using techniques known in the art and described in the present invention, such as in the examples provided below. In some embodiments, there is at least a 10-fold difference between target and non-target hybridization signals in a test sample, at least a 100-fold difference, or at least 1,000. time. In some embodiments, the non-target hybridization signals in a test sample are not greater than the level of the background signal.
By "stringent hybridization conditions" or "stringent conditions" is meant conditions which allow an oligomer to preferentially hybridize to a target nucleic acid and not to a nucleic acid derived from a tightly bound non-target nucleic acid. Although the definition of stringent hybridization conditions does not vary, the actual reaction environment that can be used for stringent hybridization may vary depending on factors such as GC content and length of oligomer, degree of similarity between the oligomeric sequence and non-target nucleic acid sequences which may be present in the test sample, and the target sequence. Hybridization conditions include temperature and composition of reagents or hybridization solutions. Examples of hybridization test conditions for amplifying and / or detecting target nucleic acids derived from at least one GBS serotype with the oligomers of the present invention correspond to a temperature of about 60 ° C when the salt concentration , such as a monovalent salt, eg, KCl, is in the range of about 0.6 to 0.9 M. Other acceptable stringent hybridization conditions are readily determined by one skilled in the art.
By "test conditions" is meant conditions allowing stable hybridization of an oligonucleotide to a target nucleic acid. The test conditions do not require preferential hybridization of the oligonucleotide to the target nucleic acid.
The “label” or the “detectable label” refers to a fraction or to a BE2019 / 5528 compound linked directly or indirectly to a detected probe or leading to a detectable signal.
The direct junction can use covalent bonds or non-covalent interactions (for example, hydrogen bonds, hydrophobic or ionic interactions, and the formation of chelates or coordination complexes), while the indirect junction can use a bridging moiety or a linker (eg, via an antibody or at least one additional oligonucleotide, which amplifies a detectable signal). Any detectable fragment can be used, for example, a radionuclide, a ligand such as biotin or avidin, an enzyme, an enzyme substrate, a reactive group, a chromophoret such as a dye or a particle (for example, a latex or metal bead) which confers a detectable color, a luminescent compound (eg, a bioluminescent, phosphorescent, or chemiluminescent compound) and a fluorescent compound (i.e. a fluorophore). Embodiments of the fluorophores include those which absorb light in the range of about 495-650nm and emit light in the range of about 520-670nm, which include those called FAMTM, TETTM, CAL FLUORTM (orange or red), and QUASARTM., Fluorophores can be used in combination with a quencher molecule that absorbs light near the fluorophore to reduce background fluorescence.
Such extinguishers are well known in the art and include, for example, the BLACK HOLE EXTINCTEURTM compounds (or
BHQ7M) or TAMRATM, Particular embodiments include a "homogeneous detectable label" which is detectable in a homogeneous system in which the labeled probe bound in a mixture exhibits a detectable change from the unlabeled labeled probe, which allows for detecting the label without physically removing the hybridized probe from the unhybridized labeled probe (e.g., U.S. Patent Nos. 5,283,174,
5,656,207 and 5,658,737). Particular homogeneous detectable markers include chemiluminescent compounds, including acridinium ester ("AE") compounds, such as conventional AE or AE derivatives which are well known (U.S. Patent Nos. 5,656,207, 5,658,737 and 5,639,604). The methods of synthesizing tags, attaching tags to nucleic acid, and detecting signals from tags are well known (eg, Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition) (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), Chapter 10 and U.S. Patents Nos. 5,658,737, 5,656,207, 5,547,842, 5,283,174 and 4,581,333, and EP Patent Application No. 0,747,706). Particular methods of binding an AE compound to a nucleic acid are known (eg, US Patents Nos. 5,585,481 and 5,639,604, see column 10, lines 6-11, line 3 and Example 8). Particular AE tag positions are the central region of a probe and near an A / T base pair region, at the 3 'or 5' end of a probe, at a mismatch site. with or near a known sequence,
which sequence should not be detected by the probe with respect to the desired BE2019 / 5528 target sequence. Other detectably labeled probes include TaqMan "M probes, molecular torches, and molecular beacons. TaqMan" M probes include a donor and acceptor label, with fluorescence being detected upon enzymatic degradation of the probe during amplification. to release the fluorophore from the presence of the extinguisher. Torches and molecular beacons come in open and closed configurations, with the closed configuration quenching the fluorophore and the open position separating the fluorophore from the quencher to allow fluorescence. Hybridization to the target opens otherwise closed probes.
The sequences are "sufficiently complementary" if they allow stable hybridization of two nucleic acid sequences, for example, stable hybrids of probe sequences and target sequences, although the sequences do not need to be completely complementary. . That is, a "sufficiently complementary" sequence that hybridizes to another sequence by hydrogen bonding between a series of complementary nucleotides using standard base pairing (e.g., G: C, À : T or À: U), although both sequences may contain at least one or more residues (including abasic positions) which are not complementary as long as the entire sequences under appropriate hybridization conditions form a hybridization complex stable. Sufficiently complementary sequences can be at least about 80%, at least about 90%, or completely complementary in sequences which hybridize together. Appropriate hybridization conditions are well known to those skilled in the art, can be predicted based on sequence composition, or can be determined empirically using routine assays (eg, Sambrook et al, Molecular Cloning, A Laboratory Manual, 2nd edition, $$ 1.90-1.91,
7.37-1.57, 9.47-9.51 and 11.47-11.57, in particular $$ 9.50-9.51, 11.12-11.13, 11.45-11.47 and
11.55-11.57).
A "non-expandable" oligomer includes a blocking moiety at or near its 3 'end to prevent expansion. A blocking group near the 3 'end is, in some embodiments, within the five residues of the 3' end and is large enough to limit the binding of a polymerase to the oligomer, and others embodiments contain a blocking group covalently linked to the 3 'end. Many different chemical groups can be used to block the 3 'end, for example, alkyl groups, non-nucleotide linking groups, alkanediol dideoxynucleotide residues, and cordycepin. Other examples of blocking moieties include a 3'-deoxy nucleotide (eg, a 2 ', 3'-dideoxy); a 3'-phosphorylated nucleotide; a fluorophore, extinguisher or other marker that interferes with extension; an inverted nucleotide (eg, linked to the previous nucleotide by a 3'.3BE2019 / 5528 3 'phosphodiester, optionally with an exposed 5'-OH or phosphate); or a protein or peptide linked to the oligonucleotide to prevent further extension of a nascent nucleic acid chain by a polymerase. A non-expandable oligonucleotide of the present invention can be at least 10 bases in length and up to 15, 20, 25, 30, 35, 40, 50 or more in length. Non-expandable oligonucleotides comprising a detectable label can be used as probes. References, in particular in the claims, to "the sequence of SEQ ID NO: X" refer to the base sequence of the corresponding sequence listing entry and do not require the identity of the backbone (e.g. RNA , 2'-O-Me RNA, or DNA) or base modifications (eg, methylation of cytosine residues) unless the context clearly indicates otherwise.
"Sample preparation" refers to any step or process that processes a sample for further amplification and / or detection of GBS nucleic acids present in the sample. Samples can be complex mixtures of components of which the target nucleic acid is a minority component. Sample preparation may include any known method of concentrating component, such as microbes or nucleic acids, from a larger sample volume, for example by filtration of particles suspended in the air or present. in the water of a larger sample volume or by isolation of microbes from a sample using standard microbiological procedures. Sample preparation may include physical disruption and / or chemical lysis of cellular components to release intracellular components in a substantially aqueous or organic phase and the removal of debris, for example by filtration, centrifugation or adsorption.
Sample preparation may include the use of a nucleic acid oligonucleotide that selectively or nonspecifically captures a target nucleic acid and separates it from other sample components (e.g., as described in U.S. Patent No. 6,110,678 and International Patent Application Publication WO 2008/016988, each cited in the present invention by reference).
"Separate" or "purify" means that at least one component of a sample is removed or separated from other sample components. Sample components include target nucleic acids usually in a generally aqueous solution phase, which may also include cell fragments, proteins, carbohydrates, lipids, and other nucleic acids. "To separate" or "to purify" does not imply a degree of purification. Typically, the separation or purification removes at least 70%, or at least 80%, or at least 95% of the target nucleic acid from BE2019 / 5528 other sample components.
The term "nonlinear surfactant" as used in the present invention refers to a surfactant having a branched chain structure. A nonlinear surfactant can comprise at least one cyclic structure, which can be found, for example, in a main chain and / or in at least one branched chain. Examples of nonlinear surfactants include polysorbate 20, polysorbate 40, polysorbate 60, and digitonin. In some variations, a nonlinear surfactant is nonionic.
The term "specificity", in the context of an amplification and / or detection system, is used in the present invention to refer to the characteristic of the system which describes its ability to distinguish target sequences from non-target sequences by depending on sequence and test conditions. In terms of nucleic acid amplification, specificity generally refers to the ratio of the number of specific amplicons produced to the number of byproducts (eg, signal-to-noise ratio). In terms of detection, specificity generally refers to the ratio of the signal produced from target nucleic acids to the signal produced from non-target nucleic acids.
The term "sensitivity" is used in the present invention to refer to the precision with which a nucleic acid amplification reaction can be detected or quantified. The sensitivity of an amplification reaction is usually a measure of the smallest copy number of the target nucleic acid that can be reliably detected in the amplification system, and depends, for example, on the detection assay used and the specificity of the amplification reaction, for example, the ratio of specific amplicons to side products.
DETAILED DESCRIPTION OF THE INVENTION The present invention relates to compositions, kits and methods for amplifying and detecting group B streptococcus (GBS; Streptococcus agalactiae) nucleic acid from a sample. Preferably, the samples are biological samples. The compositions, kits and methods provide oligonucleotide sequences which recognize target sequences of the GBS genome, including target sequences of GBS serotypes 1a, Ib, Ic, II, III, IV, V, VI, VII, VIII and IX, or their complementary sequences. Such oligonucleotides can be used as amplification oligonucleotides, which can include primers, promoter-primers, blocked oligonucleotides and promoter supplier oligonucleotides,
whose functions have been described previously (see, for example, US patents BE2019 / 5528 4,683,195; 4,683,202; 4,800,159; 5,399,491; 5,554,516; 5,824,518 and 7,374,885, each cited in the present invention by way of reference). Other oligonucleotides can be used as probes to detect amplified sequences of GBS or to capture target nucleic acid at GBS.
The methods allow for the sensitive and specific detection of GBS nucleic acids.
The methods include performing nucleic acid amplification of a target region to GBS and detecting the amplified product, for example, by specific hybridization of the amplified product using a nucleic acid detection probe. which provides a signal indicating the presence of GBS in the sample.
The amplification step comprises contacting the sample with at least one amplification oligomer specific for a target sequence in a GBS target nucleic acid to produce an amplified product if a GBS nucleic acid is present. in the sample.
Amplification synthesizes additional copies of the target sequence or its complement using at least one nucleic acid polymerase and amplification oligomer to produce the copies from a template strand (e.g. example, by extending the sequence from a primer using the template strand). One embodiment for detecting the amplified product uses a hybridization step which comprises contacting the amplified product with at least one detection probe oligomer specific for a sequence amplified by the selected amplification oligomers, e.g. , a sequence present in the target sequence flanked by a pair of selected amplification oligomers.
Preferred compositions of the present invention are configured to specifically hybridize to nucleic acid of all GBS, Ia, Ib, le, II, HI, IV, V, VL, VII, VIII and IX serotypes exhibiting reactivity. minimal crossover to other GBS nucleic acids suspected of being present in a sample (eg, other bacterial pathogens). In certain variants, the compositions of the invention further allow the detection of sequences on a non-hemolytic strain of GBS.
In certain aspects, the compositions of the present invention are configured to specifically hybridize to GBS nucleic acid exhibiting minimal cross-reactivity with one or more non-GBS pathogens listed in any one of Tables 9-11, 15, 16, 20 and 22 (see Examples, infra). In one aspect, the compositions of the present invention are part of a multiplex system that further includes components and methods for detecting one or more of such non-GBS pathogens.
In accordance with certain aspects of the invention, a composition comprising at least two amplifying oligomers is provided for determining the presence or absence of GBS in a sample.
Typically, the composition comprises at least two BE2019 / 5528 amplification oligomers intended to amplify a target region of a target GBS nucleic acid corresponding to the sequence of SEQ ID N °: 1 (SIP gene) or of SEQ ID N °. : 2 (CFB gene). In these embodiments, at least one amplifying oligomer comprises a target hybridization sequence in sense orientation ("sense THS") and at least one amplifying oligomer comprises a target hybridization sequence in the sense orientation. antisense orientation ("antisense THS"), where the sense THS and the antisense THS are each configured to specifically hybridize to a target sequence of GBS corresponding to a sequence present in SEQ ID No: 1 or SEQ ID N °: 2 and where the target hybridization sequences are chosen such that the GBS sequence targeted by the antisense HRT is downstream of the GBS sequence targeted by the sense HRT (i.e. the at least two amplification oligomers are located such that they flank the target region to be amplified). In some variants, a composition comprises (i) an SP-specific amplification oligomer comprising an S / P-specific target hybridization sequence corresponding substantially or identical to the sequence shown in SEQ ID NO: 3, SEQ ID NO: : 4, SEQ.ID NO: 7, or SEQ ID NO: 8, or their complement or RNA equivalent or a DNA / RNA chimera thereof.
In some variations, a composition comprises (it) a CFB-specific amplification oligomer comprising a CFB-specific target hybridization sequence that is from about 17 to about 24 contiguous nucleotides and substantially or identical to a sequence that is present. in the sequence of SEQ ID NO: 26, or its complement or an RNA equivalent or a DNA / RNA chimera thereof; in some of these embodiments, the CFB-specific target hybridization sequence comprises a sequence which substantially corresponds or is identical to the sequence of SEQ ID NO: 28 or of SEQ ID NO: 27, or their complement or a RNA equivalent or a DNA / RNA chimera thereof (e.g., a sequence substantially corresponding or identical to the sequence shown in SEQ ID NO: 12 or SEQ ID NO: 14, or their complement or a RNA equivalent or a DNA / RNA chimera thereof), or is a sequence corresponding substantially or identical to the sequence given in SEQ ID NO: 18, or its complement or an equivalent of RNA or chimera d DNA / RNA thereof.
In certain variants, a composition comprises (iii) a CFB-specific amplification oligomer comprising a CFB-specific target hybridization sequence corresponding substantially or identical to the sequence indicated in SEQ ID No: 13, SEQ ID No: 15 , SEQ ID No: 16, SEQ.ID No: 17, or SEQ ID No: 20, or SEQ ID No: 21 or their complement or an RNA equivalent or a DNA / RNA chimera of those -this.
In variants comprising an S / P or CFB- specific amplification oligomer of (1), (ii) or (iii) as above, the combination of oligomers comprises at least one amplification oligomer comprising a sequence target hybridization specific to S / P or to CFB of BE2019 / 5528 opposite polarity (sense versus antisense or vice versa) as target hybridization sequence of the oligomer of (1), (ii) or (tij), such that at least two amplifying oligomers flank a target region to be amplified. In some embodiments, the composition is provided as an aqueous or dried formulation for nucleic acid amplification to GBS, or a reaction mixture comprising or reconstituted from such a formulation. In more specific embodiments of the present invention, a composition for determining the presence or absence of GBS in a sample comprises (1) at least one amplification oligomer comprising a target hybridization region specific to S / P or CFB substantially corresponding to at least one sense oligomer sequence described in Table 1 below, and (2) at least one amplification oligomer comprising a target hybridization region specific to S / P or CFB corresponding substantially to at least one antisense oligomer sequence described in Table 1. In some of these embodiments, the composition comprises a first S / P specific amplification oligomer and a first CFB specific amplification oligomer of (1) above and a second S / P specific amplification oligomer and a second CFB of (2) above. In particular variants, at least one sense and / or antisense target hybridization sequence of a combination of amplification oligomers comprises or consists of at least one sense and / or antisense sequence chosen from the table 1.
Table 1: Examples of target hybridization sequences of sense and - antisense amplification oligomers for amplification of target regions of GBS SIP or CFB NO: 1 | eere | Donkey | _SIP__ a | AshaTarorerTGATTGG0GAA | Donkey [7
NO:! The Sense / Antisense designation of these sequences is given as an example only.
This designation does not necessarily limit a sequence of the accompanying designation.
In some variations, a composition for determining the presence or absence of GBS in a sample as described in the present invention further comprises at least one detection probe oligomer configured to specifically hybridize to a target S / sequence. P or CFB to GBS amplifiable using the first and second amplification oligomers (for example, a SIP or CFB target sequence present in SEQ ID No: 1 or SEQ ID No: 2, or their complement, which is flanked by the target hybridization sequences of the first and second amplification oligomers). Particularly suitable S / P-specific detection probe oligomers include, for example, oligomers comprising an SP-specific target hybridization sequence corresponding substantially or identical to the sequence shown in SEQ ID NO: 9 or SEQ ID NO: : 11, or their complement or an RNA equivalent or a DNA / RNA chimera thereof.
Particularly suitable CFB-specific detection probe oligomers include, for example, oligomers comprising a CFB-specific target hybridization sequence corresponding substantially or identical to the sequence shown in SEQ ID NO: 22, NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or their complement or an RNA equivalent or a DNA / RNA chimera thereof.
A detection probe oligomer can contain a 2'-methoxy backbone at one or more bonds in the nucleic acid backbone.
In some variations, a composition comprises at least two detection probe oligomers.
In some embodiments, a detection probe oligomer is provided in an aqueous or dried formulation for the detection of GBS nucleic acid, or a reaction mixture comprising or reconstituted from such formulation. , a detection probe oligomer according to the present invention further comprises a label.
Particularly suitable labels include compounds which emit a detectable light signal, eg, fluorophores or luminescent compounds (eg, chemiluminescent) detectable in a homogeneous mixture.
Several markers and several types of markers may be present on a particular probe, or detection may be based on the use of a BE201 9/5528 mixture of probes in which each probe is labeled with a compound which produces a detectable signal (see, for example, US-A-6,180,340 and 6,350,579, each cited in the present invention by reference). The labels can be attached to a probe by a variety of means, including covalent bonds, chelation, and ionic interactions, but preferably the label is covalently attached. For example, in some embodiments, a detection probe has an attached chemiluminescent label such as, for example, an acridinium ester (AE) compound (see, for example, U.S. Patent Nos. 5,185,439; 5,639,604; 5,585,481 and 5,656,744; each cited in the present invention by reference). A label, such as, for example, a fluorescent or chemiluminescent label, is typically attached to the probe by a non-nucleotide linker (see, for example, U.S. Patent Nos. 5,585,481; 5,656,744; and 5,639,604, particularly at column 10, row 6 to column 11, row 3 and example 8, each cited in the present invention by way of reference).
In some embodiments, a probe (including, for example, a fluorescent label) further includes a second label that interacts with the first label. For example, the second marker can be a fire extinguisher. Detection probes, comprising both a fluorescent label and a quencher, a combination, are particularly useful in fluorescence resonance energy transfer (FRET) assays. Specific variations of such detection probes include, for example, a TaqManTM detection probe (Roche Molecular Diagnostics) and a "molecular beacon" (see, e.g., Tyagi et al., Nature Biotechnol. 16: 49-53, 1998) U.S. Patent Nos. 5,118,801 and 5,312,728, each of which is incorporated herein by reference). TaqManTM probes (or similar double-labeled linear probes comprising both fluorescent label and quencher), can be used in assays where hybridization of the probe to a target or an amplicon followed by nucleolysis by a polymerase comprising 5'-3 'exonuclease activity results in the release of the fluorescent label and hence increased fluorescence, or fluorescence independent of the interaction with the second label.
In some applications, a detection probe exhibiting at least some degree of self-complementarity is used to facilitate detection of probe: target duplexes in a test sample without first requiring the removal of the unhybridized probe prior to detection. Specific embodiments of such detection probes include, for example, probes which form conformations maintained by intramolecular hybridization, such as generally referred to as hairpin conformations. Suitable hairpin probes include a "torchemolecular" (see, e.g., U.S. Patent Nos. 6,849,412; 6,835,542; BE2019 / 5528 6,534,274; and 6,361,945) and a "molecular beacon" (see, e.g., U.S. Patents n ° 5,118,801 and 5,312,728). Molecular torches include distinct regions of self-complementarity ("target binding domain" and "target closing domain") that are joined by a junction region (eg, a linker - (CH> CH: 0) s ) and which hybridize to each other under predefined hybridization analysis conditions. When exposed to an appropriate target or denaturing conditions, the two complementary regions (which may be fully or partially complementary) of the molecular torch melt, leaving the target binding domain available for hybridization to a target sequence when the predefined hybridization test conditions are restored. Molecular torches are designed so that the target binding domain promotes hybridization to the target sequence over the target closing domain. The target binding domain and the target closing domain of a molecular torch include interacting markers (e.g., fluorescent / quencher) positioned so that a different signal is produced when the molecular torch self-hybridizes. as opposed to hybridizing the molecular torch to a target nucleic acid, thereby allowing detection of probe: target duplexes in a test sample in the presence of an unhybridized probe having a viable label associated therewith.
In other embodiments, a detection probe is a linear oligomer which does not substantially form conformations maintained by intramolecular bonds. In specific variations, a linear detection probe oligomer includes a chemiluminescent compound as a label (eg, an acridinium ester (AF) compound). In other embodiments, a linear detection probe oligomer includes a fluorophore as a label. In certain embodiments of a linear detection probe oligomer comprising a fluorophore, the oligomer further comprises an quencher moiety (eg, a TaqMan probe).
Examples of interacting donor / acceptor tag pairs that can be used within the scope of the disclosure, without seeking to distinguish FRET pairs from non-FRET pairs, include fluorescein / tetramethylrhodamine, IAEDANS / fluorescein dye, '' EDANS / DABCYL, coumarin / DABCYL, fluorescein / fluorescein, BODIPY FL / BODIPY FL, fluorescein / DABCYL, luciferous yellow / DABCYL, BODIPY / DABCYL, eosin / DABCYL, erythrosin / DABCYL, tetramethylrhodamine / DABCYL, Texas red / DABCYL, CY5 / BH1, CY5 / BH2, CY3 / BH1, CY3 / BH2 and fluorescein / QSY7. One of ordinary skill in the art will understand that when the donor and acceptor dyes are different, energy transfer can be detected by the appearance of sensitized fluorescence from the acceptor or by quenching fluorescence from the donor. Non-fluorescent acceptors such as the BE2019 / 5528 dyes DABCYL and QSY7 advantageously eliminate the potential problem of background fluorescence resulting from direct (i.e. non-sensitized) excitation of the acceptor. Examples of fluorophore moieties that can be used as a member of a donor-acceptor pair include fluorescein, ROX and CY dyes (such as CY5). Examples of quencher moieties that can be used as a member of a donor-acceptor pair include the DABCYL and BLACK HOLE QUENCHER moieties available from Biosearch Technologies, Inc, (Novato, Calif.).
In some embodiments, a labeled oligomer (eg, a detection probe) is non-expandable. For example, the labeled oligomer can be made non-extensible by 3'-phosphorylation, having a 3'-terminal 3'-deoxynucleotide (eg, a 2 ', 3'-dideoxynucleotide), having a 3' inverted nucleotide. -terminal (for example, in which the last nucleotide is inverted such that it is linked to the penultimate nucleotide by a 3 'to 3' phosphodiester bond or an analogue thereof, such as a phosphorothioate), or comprising a fluorophore, an attached quencher, or any other label that interferes with extension (optionally but not necessarily attached through the 3 'position of the terminal nucleotide). In some embodiments, the 3'-terminal nucleotide is not methylated.
The present invention also provides compositions comprising one or more detection probe oligomers as described in the present invention.
In certain aspects, the present invention provides methods using an oligomer or a combination of oligomers as described in the present invention. Any process described in the present invention should also be understood as a disclosure of corresponding uses of the materials involved in the process and aimed at the purpose of the process. Any of the oligomers comprising a target S / P or CFB to GBS hybridization sequence and any combination (eg, kits and compositions) comprising such an oligomer should be understood as also described for use in detection or quantifying GBS, and for use in preparing a composition for detecting or quantifying GBS.
Generally, the methods may include one or more of the following components: target capture, in which the GBS nucleic acid (eg, from a sample, such as a clinical sample) is annealed to an oligomer of capture; isolation, eg washing, to remove material not associated with a capture oligomer; amplification; and detection of amplicons, for example, quantification of amplicons, which can be performed in real time using amplification.
Some embodiments involve each of the preceding steps. Some dBE2019 / 5528 embodiments involve exponential amplification, possibly with a previous linear amplification step. Some embodiments involve exponential amplification and amplicon detection. Some embodiments involve two of the components listed above. Some embodiments involve two components listed adjacent above, for example, washing and amplification, or amplification and detection. In certain embodiments, the present invention provides a method for determining the presence or absence of group B streptococcus (GBS) in a sample using a combination of oligomers as described in the present invention. . Such a method generally comprises (1) contacting the sample with at least two amplification oligomers to amplify a target region of S / P or CFB to GBS nucleic acids corresponding to an S7P or CFB target nucleic acid, where the at least two amplification oligomers are as described above; (2) performing an in vitro nucleic acid amplification reaction, where any SBS or CFB to GBS target nucleic acid present in the sample is used as a template to generate an amplification product; and (3) detecting the presence or absence of the amplification product, thereby determining the presence or absence of GBS in the sample. A detection method according to the present invention typically further comprises the step of obtaining the sample to be contacted with the at least two amplification oligomers. In some embodiments, "obtaining" a sample for use in steps (1) to (3) includes, for example, receiving the sample at a testing facility or other location where one or more multiple process steps are performed, and / or sample recovery from a location (e.g., from storage or other depot) in a facility where one or more process steps are carried out.
Amplification of a target sequence of GBS uses an in vitro amplification reaction using at least two amplification oligomers that flank a target region to be amplified. In particular embodiments, the target region to be amplified is an STP to GBS target region corresponding substantially to SEQ ID NO: 1 from about nucleotide position 56 to about nucleotide position 189 or from about nucleotide position 349 to about. about nucleotide position 489. Particularly suitable combinations of oligomers for the amplification of these target regions S / S to GBS are described in the present invention. For example, in some embodiments, a combination of amplification oligomers for amplifying a SIP target region comprises first and second S / P specific amplification oligomers comprising, respectively, (A) a first sequence of target hybridization specific to S / P which is SEQ
ID No: 3 or a sequence corresponding substantially to SEQ ID No: 3, or an equivalent BE2019 / 5528 of RNA or a DNA / RNA chimera thereof, and (B) a second hybridization sequence target specific to SIP which is SEQ ID NO: 4 or a sequence substantially corresponding to SEQ ID NO: 4, or an RNA equivalent or a DNA / RNA chimera thereof. In other embodiments, a combination of amplification oligomers for amplifying a SIP target region comprises first and second S / P specific amplification oligomers comprising, respectively, (A) a first hybridization sequence target specific to SIP which is SEQ ID No: 7 or a sequence corresponding substantially to SEQ ID No: 7, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) a second SIP-specific target hybridization sequence which is SEQ ID NO: 8 or a sequence substantially corresponding to SEQ ID NO: 8, or an RNA equivalent or a DNA / RNA chimera thereof.
In other embodiments, the target region to be amplified is a CFB to GBS target region corresponding substantially to SEQ ID NO: 2 from about nucleotide position 38 to about nucleotide position 151, from about nucleotide position 22 to. from about nucleotide position 151, from about nucleotide position 192 to about nucleotide position 329, or from about nucleotide position 585 to about nucleotide position 716. Combinations of oligomers particularly suitable for amplifying these target regions CFB to GBS are described in the present invention. For example, in some embodiments, a combination of amplification oligomers for amplifying a target region of CFB comprises first and second CFB-specific amplification oligomers comprising, respectively, (A) a first hybridization sequence CFB-specific target which is from about 17 to about 24 contiguous nucleotides and corresponding substantially to, or identical to, a sequence which is present in the sequence of SEQ ID NO: 26, or an RNA equivalent or a chimera of DNA / RNA thereof, and (B) a second target hybridization sequence specific to CFB which is SEQ ID No: 13 or SEQ ID No: 15 or a sequence corresponding substantially to SEQ ID No: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; in more specific variants of such a first CFB-specific target hybridization sequence of (A), the CFB-specific target hybridization sequence is selected from (1) a sequence which substantially corresponds or is identical to the sequence of SEQ ID NO: 28 or SEQ ID NO: 27, or an RNA equivalent or DNA / RNA chimera thereof (e.g., a sequence which is SEQ ID NO: 12 or SEQ ID NO: : 14 or a sequence which substantially corresponds to SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or a DNA / RNA chimera thereof), and (ii) a sequence which is SEQ ID No: 18 or a sequence substantially corresponding to SEQ ID
No: 18, or an equivalent of RNA or DNA / RNA chimera thereof. In other embodiments of BE2019 / 5528, a combination of amplification oligomers for amplifying a CFB target region comprises first and second CFB-specific amplification oligomers comprising, respectively, (A) a first hybridization sequence CFB-specific target which is SEQ ID No: 16 or a sequence substantially corresponding to SEQ ID No: 16, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) a second CFB-specific target hybridization sequence which is SEQ ID NO: 17 or a sequence substantially corresponding to SEQ ID NO: 17, or an RNA equivalent or a DNA / RNA chimera thereof. In other embodiments, a combination of amplification oligomers for amplifying a CFB target region comprises first and second CFB-specific amplification oligomers comprising, respectively, (A) a first target specific hybridization sequence to CFB which is SEQ ID No: 18 or a sequence corresponding substantially to SEQ ID No: 18, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) a second sequence d CFB-specific target hybridization which is SEQ ID NO: 15 or a sequence substantially corresponding to SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof. In other embodiments, a combination of amplification oligomers for amplifying a CFB target region comprises first and second CFB-specific amplification oligomers comprising, respectively, (A) a first target specific hybridization sequence to CFB which is SEQ ID No: 20 or a sequence corresponding substantially to SEQ ID No: 20, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) a second sequence d CFB-specific target hybridization which is SEQ ID NO: 21 or a sequence substantially corresponding to SEQ ID NO: 21, or an RNA equivalent or a DNA / RNA chimera thereof. A detection method according to the present invention may further comprise the step of obtaining the sample to be subjected to the subsequent steps of the method. In some embodiments, "obtaining" a sample for use includes, for example, receiving the sample at a testing facility or other location where one or more process steps are performed, and / or recovering the sample from a location (eg, from a storage or other depot) in a facility where one or more process steps are performed.
In some embodiments, the method further comprises purifying the GBS target nucleic acid from other sample components, for example, before amplification, such as before a capture step. This purification may include methods of separating and / or concentrating the organisms present in a sample from other sample components, or the removal or degradation of non-nucleic acid sample components, for example, protein, carbohydrate, salt, lipid, etc. In some embodiments, the DNA in the sample is degraded, for example BE2019 / 5528, by DNAse, and possibly the removal or deactivation of DNA or the removal of degraded DNA.
In particular embodiments, the purification of the target nucleic acid comprises capturing the target nucleic acid to specifically or nonspecifically separate the target nucleic acid from other sample components. Non-specific target capture methods may involve the selective precipitation of nucleic acids from a predominantly aqueous mixture, adhesion of nucleic acids to a washed support to remove other components from the sample, or another. means of physically separating nucleic acids from a mixture containing GBS nucleic acid and other sample components Target capture typically occurs in a solution phase mixture containing one or more capture probe oligomers that are 'hybridize to the SIP or CFB target sequence in GBS under hybridization conditions. For embodiments comprising a capture probe tail, the target GBS: capture-probe complex is captured by adjusting the hybridization conditions, such that the capture probe tail hybridizes to an immobilized probe. . Some embodiments use a particulate solid support, such as paramagnetic beads.
Isolation can follow capture, where, for example, the complex on the solid support is separated from other sample components. Isolation can be accomplished by any suitable technique, for example, by washing one or more times, eg, two or three times, of a support associated with the target sequence SIP or CFB to GBS to remove. other sample components and / or unbound oligomer. In embodiments using a particulate solid support, such as paramagnetic beads, particles associated with the GBS target can be suspended in a wash solution and extracted from the wash solution, in some embodiments by use. of a magnetic attraction. To limit the number of handling steps, the S7P or CFB target nucleic acid to GBS can be amplified by simply mixing the target GBS sequence in the complex on the support with amplification oligomers and continuing the steps of amplification.
Exponential amplification of a GBS target sequence uses an in vitro amplification reaction using two or more amplifying oligomers which flank a target region to be amplified. In some embodiments, at least the first and second oligomers as described in the present invention are provided. In some embodiments, a plurality of pairs of oligomers are provided; in some of these variations, a plurality of pairs of oligomers include pairs of BE2019 / 5528 oligomers configured to hybridize to at least two target nucleic acids at GBS (e.g., at least one pair of oligomers configured for s' hybridize to an S / P target nucleic acid and at least one pair of oligomers configured to hybridize to a CFB target nucleic acid).
The amplification reaction can be cyclic or isothermal. Suitable amplification methods include, for example, replicase mediated amplification, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and transcription-mediated or transcription-associated amplification (TMA).
A detection step can be performed using any of a variety of known techniques to detect a signal specifically associated with the amplified target sequence, such as, for example, hybridization of the amplification product to. a labeled detection probe and by the detection of a signal resulting from the labeled probe (including from a label released from the probe after hybridization in some embodiments). In some embodiments, the labeled probe includes a second fragment, such as a quencher or other fragment that interacts with the first label, as described above. The detection step can also provide additional information about the amplified sequence, such as, for example, all or part of its basic nucleic acid sequence. Detection can be done after the amplification reaction is complete or can be done concurrently with amplification of the target region, for example, in real time. In one embodiment, the detection step allows for homogeneous detection, eg, detection of the hybridized probe without removing the unhybridized probe from the mixture (see, eg, US Patents Nos. 5,639,604 and 5,283,174). In some embodiments, the nucleic acids are associated with a surface that causes a physical change, such as a detectable electrical change. Amplified nucleic acids can be detected by concentrating them in or on an array and detecting nucleic acids or dyes associated with them (for example, an intercalator such as ethidium bromide or cyber green) , or by detecting an increase in the dye associated with the nucleic acid in the solution phase. Other detection methods may use nucleic acid detection probes configured to specifically hybridize to a sequence of the amplified product and detect the presence of the probe: product complex, or using a complex of probes that can amplify the detectable signal associated with the amplified products (e.g., U.S. Patent Nos. 5,424,413; 5,451,503; and 5,849,481; each cited herein by reference).
Directly or indirectly labeled probes that specifically associate with the amplified product provide a detectable signal that indicates the presence of the target nucleic acid in the sample. In particular, the amplified product contains a target sequence or BE2019 / 5528 complementary to a sequence in the S / P or CFB gene to GBS, and a probe directly or indirectly binds to a sequence present in the amplified product to indicate the presence nucleic acid to GBS in the test sample.
In embodiments which detect the amplified product at or near the end of the amplification step, a linear detection probe can be used to provide a signal indicating hybridization of the probe to the amplified product. An example of such detection uses a luminescently labeled probe which hybridizes with the target nucleic acid. The luminescent label is then hydrolyzed from an unhybridized probe. Detection is performed by chemiluminescence using a luminometer. (see, e.g., International Patent Application Publication WO 89/002476, cited in the present invention by reference). In other embodiments which use real-time detection, the detection probe can be a hairpin probe, such as, for example, a molecular beacon, molecular torch, or hybridization-switched probe which is labeled with a reporter fraction which is detected when the probe binds to the amplified product (eg, a double-labeled hairpin probe comprising both a fluorescent label and a quencher fraction). In other embodiments for real-time detection, the detection probe is a linear oligomer such as, for example, an oligomer labeled with both a fluorophore and a quencher (e.g., a TaqMan probe ). Such probes can include target hybridization sequences and non-target hybridization sequences. Various forms of such probes have been described previously (see, e.g., U.S. Patents Nos. 5,210,015; 5,487,972; 5,118,801; 5,312,728; 5,925,517; 6,150,097; 6,849,412; 6,835,542; 6,534,274; and 6,361,945; and U.S. Patent Application Publications no. No. 20060068417A1 and 20060194240A1; each cited in the present invention by reference).
GBS nucleic acid detection assays may optionally include a non-GBS Internal Control (IC) nucleic acid which is amplified and detected in the same test reaction mixes using the amplification and detection oligomers specific to the IC sequence. The IC nucleic acid sequences may be, for example, a DNA plasmid, an RNA template sequence (eg, an in vitro transcript), or a synthetic nucleic acid which is added to a sample. Alternatively, the IC nucleic acid sequence can be a cellular component, which can be derived from exogenous cellular sources or from cellular sources endogenous to the sample.
In these cases, an internal control nucleic acid is co-amplified with GBS nucleic acid in the amplification reaction mixes. The internal control amplification product and the GBS target sequence amplification product can be detected BE2019 / 5528 independently.
In some embodiments, amplification and detection of a signal from an amplified IC sequence demonstrates that the reagents, conditions, and performance of the test steps were correctly used in the test if no signal is present. obtained for the intended GBS target nucleic acid (for example, samples that test negative for GBS). An IC can also be used as an internal calibrator for testing when a quantitative result is desired, i.e. the signal obtained from the amplification and detection of the IC is used to define a parameter used in an algorithm for quantifying the amount of GBS nucleic acid in a sample based on the signal obtained for an amplified GBS target sequence. CIs are also useful for monitoring the integrity of one or more steps in a test. The primers and probe of the target sequence IC are configured and synthesized using any well known method, provided that the primers and the probe function are used for the amplification of the target sequence IC and for the detection. of the amplified IC sequence using substantially the same test conditions as those used to amplify and detect the target sequence at GBS. In preferred embodiments which include a purification step based on target capture, it is preferable that a target capture probe specific to the IC target is included in the assay during the target capture step. , so that the IC is treated in the test analogously to that of the target GBS analyte in all stages of the test.
The present invention also provides formulations for determining the presence or absence of GBS in a sample. In some embodiments, a formulation is an aqueous formulation comprising (1) at least two S / P or CFB specific amplification oligomers for amplification of an SP or CFB target region as described in the present invention. and (2) an organic buffer. An aqueous formulation for the amplification of a GBS nucleic acid may include one or more additional components such as, for example, a DNA polymerase enzyme, a reverse transcriptase enzyme or a detection probe oligomer. In some embodiments, a formulation is an aqueous formulation comprising (1) an S / P and / or CFB specific detection probe oligomer as described in the present invention and (2) on an organic buffer. An aqueous formulation for comprising a plurality of detection probe oligomers may comprise one or more additional components such as, for example, a surfactant, a DNA polymerase enzyme, a reverse transcriptase enzyme, or at least one amplification oligomer. Particularly suitable surfactants include, for example, polyethylene glycol mono [4-
(1,1,3,3-tetramethylbutyl) phenyl] and polyoxyethylene sorbitan fatty acid esters BE2019 / 5528 (eg, polysorbate 20, polysorbate 40 or polysorbate 60). In some embodiments, a surfactant in an aqueous detection probe formulation is a nonlinear surfactant such as, for example, a polyoxyethylene sorbitan fatty acid ester (for example, polysorbate 20, polysorbate 40 or polysorbate 60) or digitonin.
An aqueous formulation as above for amplification or detection of GBS nucleic acid may further include a swelling agent such as, for example, trehalose, raffinose or a combination thereof.
In some embodiments, an aqueous formulation such as above contains an inorganic salt such as, for example, magnesium, potassium or sodium; in some of these variations, the concentration of the inorganic salt is less than or equal to 4 mM.
A particularly suitable organic buffer for an aqueous formulation as above is Tris (2-amino-2- (hydroxymethyl) -1,3-propanediol). In a related aspect, for long term storage, an aqueous formulation as described in the present invention can be aliquoted, for example, into vials, ampoules or other containers, and dried (eg, lyophilized) according to procedures known in the art.
The dried product is generally in the form of a powder or a cake.
The containers are then sealed.
The methods of preparing such dried formulations from the aqueous formulation, as well as the dried formulations prepared by these methods, are further aspects of the present invention.
In another aspect, the present invention provides a dried formulation which allows reconstitution into an aqueous formulation as described in the present invention.
Dried formulations intended for the amplification or detection of GBS nucleic acid contain, in addition to one or more amplification oligomers and / or detection probes as described in the present invention, an agent swelling such as, for example, trehalose, raffinose or a combination thereof.
In some embodiments further comprising an inorganic salt, the percentage by mass of the inorganic salt relative to the mass of the dried formulation is less than or equal to 0.249%, less than or equal to 0.222%, less than or equal to 0.195%. Methods of preparing a dried formulation from a lyophilized formulation as described in the present invention are also encompassed by the present invention; these methods generally include dissolving the dried formulation in an appropriate diluent (eg, organic buffer or water) to provide a reconstituted formulation.
The present invention also provides a reaction mixture for determining the presence or absence of a GBS target nucleic acid in a sample.
A reaction mixture according to the present invention comprises one or both (1) combinations of oligomers, as described in the present invention, intended for the amplification of a BE2019 / 5528 target nucleic acid SBS and / or CFB to GBS and (2) one or more detection probe oligomers, as described in the present invention, for determining the presence or absence of an S / P and / or CFB amplification product at GBS. The reaction mixture can further comprise a number of optional components such as, for example, capture probes, for example, poly- (k) capture probes as described in US Patent 2013/0209992, which is incorporated into the present invention by reference. For an amplification reaction mixture, the reaction mixture will typically include other reagents suitable for performing in vitro amplification such as, for example, suitable buffers, salines, nucleotide triphosphates (eg, dATP, dCTP, dGTP and dTTP; and / or ATP, CTP, GTP and UTP), and / or enzymes (eg, thermostable DNA polymerase, or reverse transcriptase and / or RNA polymerase), and will typically include sample components of test, in which a GBS target nucleic acid may or may not be present. A reaction mixture may comprise amplification oligomers for a single target region of a GBS genome, or may comprise amplification oligomers for multiple GBS target regions (eg, a target region of S / P and a region. CFB target). Further, for a reaction mixture which comprises a detection probe having a combination of amplification oligomers, the selection of amplification oligomers and detection probe oligomers of a reaction mixture are connected by a common target region. (eg, the reaction mixture comprises a probe which binds to a sequence amplifiable by a combination of amplification oligomers of the reaction mixture). In some embodiments, a reaction mixture comprises an aqueous formulation as described above. In some embodiments, a reaction mixture is reconstituted using water or an organic buffer from a dried formulation as described above.
The present invention also provides kits for performing the methods as described in the present invention. A kit according to the present invention comprises one or both (1) combinations of oligomers, as described in the present invention, for the amplification of a target nucleic acid SBS and / or CFB to GBS and (2 ) one or more detection probe oligomers, as described in the present invention, for determining the presence or absence of an S / P and / or CFB amplification product to GBS. In some embodiments, any combination of oligomers described in the present invention is present in the kit. The kits can further include a number of optional components such as, for example, capture probes, for example, poly- (k) capture probes, as described in US Pat.
2013/0209992. Other reagents which may be present in the kits include reagents BE2019 / 5528 suitable for performing in vitro amplification such as, for example, appropriate buffers, saline solutions, nucleotide triphosphates (eg, dATP, dCTP, dGTP, dTTP ; and / or ATP, CTP, GTP and UTP) and / or enzymes (eg, thermostable DNA polymerase, or reverse transcriptase and / or RNA polymerase). Oligomers as described in the present invention can be packaged in a variety of different embodiments, and one skilled in the art will appreciate that the description encompasses many different kit configurations. For example, a kit may include amplification oligomers for a single target region of a GBS genome, or may include amplification oligomers for multiple GBS target regions (eg, a target region of S / P and a target region of CFB). Additionally, for a kit that includes a detection probe having a combination of amplification oligomers, the selection of amplification oligomers and detection probe oligomers from a kit are linked by a common target region (e.g. (example, the kit includes a probe that binds to a sequence amplifiable by a combination of amplification oligomers from the kit). In certain embodiments, the kit further comprises a set of instructions for carrying out the methods according to the present invention, the instructions possibly being associated with a package insert and / or with the packaging of the kit or of the kit. its components. The invention is also illustrated by the following non-exhaustive examples.
Example 1 Seventeen combinations of primers and probes, as shown in Table 2, were evaluated for the detection of Streptococcus agalactiae (GBS) in vitro. Table 2: Combinations of primers and probes 1 SIP forward 2 SIP reverse 2 SIP probe 2 (SEQ ID No: 3) (SEQ ID No: 4) (SEQ ID No: 9) 2 SIP forward 3 SIP reverse 3 S / P probe 3 (SEQ ID N °: 5) (SEQ ID N °: 6) (SEQ ID N °: 10) 3 SIP forward 8 SIP reverse 8 bis S / P probe 8 (SEQ ID N °: 7 ) (SEQ ID N °: 8) (SEQ ID N °: 11) CFB before 1 CFB reverse 1 Probe CFB 1 (SEQID N °: 12) (SEQID N °: 13) (SEQID N °: 22) 5 CFB before 1 inverse CFB 1 CFB probe 1bis (SEQ ID N °: 12) (SEQ ID N °: 13) (SEQ ID N °: 23) CFB before 1 CFB inverse 2bis Probe CFB 1 (SEQ ID N °: 12) (SEQ ID No: 15) (SEQ ID No: 22)
7 CFB forward 1 CFB reverse 2bis Probe CFB 1bis (SEQ ID N °: 12) (SEQ ID N °: 15) (SEQ ID N °: 23)
Front CFB 2 Reverse CFB 2bis CFB 1 probe (SEQ ID N °: 14) (SEQ ID N °: 15) (SEQ ID N °: 22) Front CFB 2 Reverse CFB 2bis CFB 1bis probe (SEQ ID N °: 14) (SEQ ID No: 15) (SEQ ID No: 23)
10 Forward CFB 2 Reverse CFB 1 CFB 1 probe (SEQ ID N °: 14) (SEQ ID N °: 13) (SEQ ID N °: 22) 11 Front CFB 2 Reverse CFB 1 CFB 1bis probe (SEQ ID N °: 14) (SEQ ID No: 13) (SEQ ID No: 23)
12 Forward CFB 3 Reverse CFB 3 CFB 3 probe (SEQ ID N °: 16) (SEQ ID N °: 17) (SEQ ID N °: 24)
13 Front CFB 4 Reverse CFB 1 CFB 1 probe (SEQ ID N °: 18) (SEQ ID N °: 13) (SEQ ID N °: 22) 14 Front CFB 4 Reverse CFB 1 CFB 1bis probe (SEQ ID N °: 18) (SEQ ID No: 13) (SEQ ID No: 23)
15 Forward CFB 4 Reverse CFB 2bis CFB 1 probe (SEQ ID N °: 18) (SEQ ID N °: 15) (SEQ ID N °: 22) 16 Front CFB 4 Reverse CFB 2bis CFB 1bis probe (SEQ ID N °: 18) (SEQ ID No: 15) (SEQ ID No: 23)
17 Forward CFB 5 Reverse CFB 5 CFB 5 probe (SEQ ID N °: 20) (SEQ ID N °: 21) (SEQ ID N °: 25)
Materials and processes.
As input material, an undefined GBS serotype from clinical culture was used.
It was extracted from several replicates using the Pure MagNA 96 system (Roche). After extraction, the DNA concentration was determined by measurement OD 260/280. PCR was performed on the Applied Biosystems system (ABD® 7500 FAST Real-Time PCR.
The PCR profile used was as follows: Table 3: bi TLL PCR profile All samples were tested without adding internal control to the samples.
A GBS target nucleic acid concentration (1000 copies / µl in PCR) was used and tested in four replicates.
The concentration of the primers was set at 600 nM and the concentration of the probe was 200 nM.
Results.
Table 4 shows the Cts and the number of positive reactions for the different primer / probe combinations.
The indicated Ct is the cycle in which the relative fluorescent unit (RFU) signal exceeds a defined RFU threshold value.
Table 4 BE2019 / 5528 Combination | Ct (mean) number of positive reactions
24.81
25.66 4 | 25.69
27.51 6 | 4D
26.79 |. 8 | 24.96 |. 9 | 27.62 25.25 27.60 25.50 19.92 27.65 26.03 25.62 24.95 For each target gene, two combinations of primers and probes were chosen for further evaluation, based on base of these data. For CFB, combinations 12 and 17 showed the lowest value in combination with the highest RFU. For S / P, combinations 1 and 3 were chosen. These combinations were tested on lower concentrations of GBS target nucleic acids allowing better discrimination. The results shown in Table 5 were obtained by testing 1, 10 and 100 copies / µl in PCR. Table 5 Combination Ct Ct Ct (mean) | (average) | (average) 1 copy / ul | 10 copies / ul | 100 copies / ul
39.19 35.22 31.77 37.41 33.61 30.36 38.34 35.02 32.41 38.44 35.10 31.70 Combinations 1, 3, 12 and 17 were also tested on 1 and 10 copies / ul with different concentrations of primer / probes (600/200 nM, 400/150 nM and 300/100 nM). Table 6 shows the results obtained with these different concentrations.
Table 6 BE2019 / 5528 600/200 nM 400/150 nM 300/100 nM Ct Ct Ct Ct Ct Ct (average) | (average) | (average) | (average) | (average) | (average) 1 copy / ul | 10 copies / ul | 1copy / ul | 10 copies / ul | 1 copy / ul | 10 copies / ul 38.51 34.91 40.09 36.26 39.65 36.98 36.85 33.73 38.89 34.44 38.84 35.54 38.31 35.00 38.89 35 , 34 39.02 35.68 37.10 34.44 38.29 35.13 39.53 35.76 Conclusion.
Based on the results summarized above, primer / probe combinations 3 and 17 (for target genes SIP and CFB, respectively) were chosen for further evaluation of sensitivity and specificity.
These combinations of primers were able to detect five (5) theoretical copies by PCR reaction at a Ct of 36 to 37. Example 2 For the detection of the internal control, two combinations of primers and probes were evaluated: SD-PLP / GIC combination and New-GIC combination comprising the sequences of primers and probes, as indicated in Table 7. The first step consisted of verifying which set of oligo gave the best results during the use of Cy5 as a fluorophore and at what concentration.
The second step focused on choosing the concentration containing the QUASAR®705 dye. On the PANTHER FUSION® Automated System, the Cy5 dye emits weak signals and should be detected using a QUASAR705 dye. The signal of Cy5 being different from the signal generated by QUASAR705, the concentration of primers and probes was re-evaluated.
Table 7: Internal control primers and probes Sequence (5'-3 ') SD-PLP-before ACAGACAATGGCAGCAATTTCACCAG (SEQ ID N °: 29) SD-PLP-reverse CTCTTCTTTGTCTCTAATTGACC (SEQ ID N °: 30) GIC probe AAACATCGCAAGCTTGCCQACA ID N °: 31) New-GIC-3_F TGGTAGCAGTTCATGTAGCCA (SEQ ID N °: 32) New-GIC-3_R CTGGCCATCTTCCTGCTAAT (SEQ ID N °: 33) New-GIC-3_P TTCCTGCCCTGTTTCTGCTGGA (SEQ ID N °: 34)
The initial testing of primers and probes was performed on the ABI 7500 FAST Real-Time PCR System after extraction ofTM KINGFISHER.
Three different concentrations of primer / probes were used: 600/200 nM, 400/150 nM and 300/100 nM.
In addition, the IC oligos were tested in combination with the SIP oligos in the presence of a GBS target (serotype II and IV: strains obtained from the University Hospital of Liège). The second step of the BE2019 / 5528 integrated circuit test was performed on the BioRad CFX-96 qPCR device, capable of detecting both Cy5 and QUASAR705. Initially, the combination of QUASAR705 was tested against the combination of Cy5 to define the final concentration of primers and probes.
Data from the initial tests showed that the New-GIC combination produced higher signals than the SD-PLP / GIC combination. The New-GIC combination (300 / 100nM) was then tested in the presence of SIP primers (600 / 200nM) and different types of GBS (serotypes II and IV in dilutions 106, 1045, 10/4). The data from this assay showed that there was no significant impact on the presence of primers and IC probes on the detection of GBS. Likewise, IC signals were not influenced by the presence of a higher concentration of GBS. Based on the data, the S / P combination at 600/200 nM (FAM) was chosen in combination with the IC New-GIC combination at 300/100 nM (Cy5).
A comparison between Cy5 dye and QUSAR705 was performed on the BioRad CFX-96. These data showed good compliance between the two conditions. The New-GIC QUASAR705 400/150 nM combination was used for further testing on GBS strains.
In the following experiment, the SZP (600 / 200n M) and New-GIC (400 / 150nM) oligos were tested on serial dilutions of the various GBS serotypes (clinical cultures collected at the Center hospitalier universitaire de Liège, university area de Sart Tilman, Bâtiment B 35, B-4000 Liège, Belgium). Table 8 below presents the ct values and shows the overall low standard deviations between the different serotypes and the different dilutions for the S7P target as well as for the New-GIC target.
Table8 Strain | Analysis as [ram ns rss [ram | Jo | os [ol om [os | 18 [ie type 0.95 1.19 0.20 0.49 1.62 1.28 a | 000 [oas | oa [oa 102 [on type 0.85 0.27 0.36 1.02 0.29 eee
Dilution 106 Dilution 105 Dilution 1074 BE2019 / 5528 30.05 37.45 28.70 33.60 30.01 30.16 Standard deviation 0.92 0.59 0.25 0.36 0.59 1.09 30.00 36.84 28.44 33.02 29.38 28.92 Standard deviation 0.62 0.40 0.18 0.53 1.57 30.26 37.34 28.86 33.26 29.53 29.12 Standard deviation 0.55 0.03 0.33 0.18 0.44 0.88 29.84 37.83 28.51 34.63 30.62 32.15 Standard deviation 0.55 0.52 0.30 0 , 34 0.47 0.54 30.36 38.05 28.41 33.38 30.40 30.48 Standard deviation 0.43 0.36 0.37 0.36 1.35 0.98 VIII 30.82 37.77 28.20 32.77 29.86 29.45 Standard deviation 1.02 0.34 0.72 0.55 1.00 1.54 30.77 38.69 28.67 35.04 29.62 30.63 Standard deviation 0.44 0.42 0.30 1.08 1.26 Overall 30.42 37.58 28.48 33.38 30.32 29.99 Standard deviation 0.22 0.36 0.17 0.13 0.45 0.48 Example 3 This example describes the evaluation of the specificity and sensitivity of the primer / probe combination 3, targeting the S / P gene to GBS.
The S / P + New-GIC mix (Cy5) was used to test different samples on the ABI 7500 FAST Real-Time PCR System after extraction from the KINGFISHERTM System.
The PCR profile shown in Table 3 above was used.
For reasons of specificity, the cross-reactivity of the strains presented in Table 9 was evaluated.
Table 9 BE2019 / 5528 sample strain faecalis | 4 | Afopobiumvaginae | BAA-55 | _ Lysate | SE + 11 rRNA copies / mL | | 6 | Bifidobacterium adolescentis | 15703 | Lysate | 1E + 08 CFU / mL | jejuni | 8 | Candida albicans | 18804 | Lysate | 1E + 08 CFU / mL | | 9 | Chlamydiatrachomatis | VR-878 | Lysate | 93E + 06IFU / ML | 16 Fusobacterium nucleatum ssp.
PA (Finegoldia magna) aureus For reasons of inclusiveness, the GBS serotypes shown in Table 10 were tested.
Table 10 BE2019 / 5528 strain Stock | 40 | Streptococcus agalactiaesérotypele | 27591 | 1E + 08 CFU / mL | THE summer | agg [his layer 13813 SE + 08 CFU / mL | 44 | Streptococcusanginosus | 33397 | 1E + 08 CFU / mL | | 46 | Streptococcus gordonii | 33399 | 1E + 08 CFU / mL | | 48 | Sireptococcusmutans | 25175 | 1E + 08 CFU / mL | | 49 | Streptococeusoralis | 10557 | 1E + 08 CFU / mL | | 60 | Streptococeuscanis | 43496 | 1E + 08 CFU / mL | | 64 | Streptococcusdysagalactiae | 43078 | 1E + 08 CFU / mL | | 66 | Sireptococcusrati | 19645 | 1E + 08 CFU / mL | | 68 | Streptococcus pseudoporcinus | DSM 18513 | 1E + 08 CFU / mL | All GBS serotypes to be detected were initially tested at the given stock concentration.
Then the strains were also tested at lower concentrations (as low as 100 CFU / mL). Table 11 below shows the specificity data obtained on the ABI 7500 FAST system.
All of the bacteria tested showed no interaction with the primers and S / P probes.
The efficiency of PCR was evaluated by a positive control, which gave positive signals.
Table 11 BE2019 / 5528 from Ct type to Ct type | Acinetobacter lwoffii | _- | - | Propionibacteriumacnes | __- | - | | Actinomyces israelii | - | - | Proteus vulgaris | - | - | Er A EE faecalis
N N aureus | Bacteroides fragilis | | | Staphylococcus epidermidis | __- | - | adoleneen | A | | adolescentis Fr ee a jejuni | Candida albicans | | Ureaplasma urealyticum | - | - | Chlamydia trachomatis | __- | | Streptococcus anginosus | __- | - | | Clostridium difficile | - | - | Streptococcus bovis | | - | | Corynebacterium genitalium | __ - | - | Streptococcus gordon | __- | - | | Cryptococcus neoformans | __- | - | Streptococcus mitis | | | | Enterobactercloacae | - | | Streptococcus mutans | | | Enterococcus faecalis | - | - | Streptococeusoralis | | | | Escherichiacoli | | - | Streptococcus parasanguinis | __- | - | Fusobacterium nucleatum M | | sramococuspramonise | | | Gardnerella vaginalis | __- | - | Streptococuespyogenes | - | | | Haemophilus ducreyi | - | - | Negative control | | - | | Klebsiella pneumoniae | _- | - | Positive control | 31875 | 0318 | | Lactobacillus acidophilus | __- | - | Positive control | 30,840 | 0.184 | | Lactobacillus crispatus | | - | | | Listeriamonocytogenes | | = | | | Mobiluncus curtis | -— | - | | | Mycoplasma hominis | - | - | | Neisseria gonorrhoeae | | | T | | Pentatrichomonas hominis | | - | OT | a man DOO (Finegoldia magna) | Prevotella bivia | JT - | T | An initial set tested at high concentrations on the ABI 7500 FAST system gave the results shown in Table 12.
Table 12 BE2019 / 5528 Strain Mean Deviation of Ct type Streptococcus agalactiae serotype la 16.705 0.007 Streptococcus agalactiae serotype Ib 17.655 0.120 Streptococcus agalactiae serotype Ic 17.715 0.332 Streptococcus agalactiae serotype III 18.240 0.151 Streoccalococcus agalactia type III 0.014 serotype III 18.240 0.151 Streoccalococcus agalactus type III 15.240 0.157 Streoccalococcus agalactus type III 15.240 0.157 Streoccalococcus agalactus type III 15.240 0.157 15.740eoccus layer 0.057 13 below shows the data obtained when the GBS strains were tested at lower concentrations (100 CFU / ml in the sample). Table 13 Serotype Concentration Mean Ct +/- standard deviation Serotype Ia 100 CFU / ml in 38.6 +/- 1.9 sample Serotype Ib 100 CFU / ml in 38.1 +/- 1.4 sample Serotype Ic 100 CFU / ml in 37.7 +/- 0.4 sample Serotype III 100 CFU / ml in 37.9 +/- 0.6 sample Serotype IV 100 CFU / ml in 38.1 +/- 1.6 the sample These serotypes (la, Ib, Ic, III, IV) were then used to test the efficiency of the PCR.
For this purpose, a serial dilution of these serotypes was prepared (ranging from 106 CFU / ml to 1041 CFU / ml) and extracted on the MagNA Pure 96 system (Roche) and PCR carried out on the ABI 7500 FAST system.
The data showed the expected slope to be approximately -3.3 and an efficacy of between 92 and 98% between the different serotypes.
In addition, the data confirmed the detection of all serotypes at 100 CFU / ml in the sample.
Example 4 This example describes the evaluation of the specificity of the primer / probe combination 3, targeting the SIP gene to GBS, on the automated PANTHER FUSION® system.
To assess specificity, the GBS strains shown in Table 15 below were tested directly on the PANTHER FUSION System, without addition of STM or Lim Broth.
The cartridges used contained SIP oligos and Cy5 oligos for integrated circuit detection. BE2019 / 5528 Table 15 sample strain | 60 | Sireprococcuscanis | 43496 | Lysate | 1E + 08 CFU / mL | | 66 | Streptococeusrari | 19645 | Lysate | 1E + 08 CFU / mL | All GBS serotypes (53-58) were detected in the FAM channel, while the other strains (59-66) were negative and provided only IC signals in the RED647 channel. This confirmed the specificity of the ZIP oligos for the strains tested.
In addition, using the same cartridges (S / P + IC (Cy5)) and testing the PANTHER FUSION System, other potential cross-reactive bacteria, and the remaining GBS serotypes as noted in Table 16, were also tested.
Table 16 rRNA sample strain / mL | 6 | Bifidobacterium adolescentis | 15703 | Lysate | 1E + 08 CFU / mL | | 8 | Candida albicans | 18804 | Lysate | 1E + 08 CFU / mL | | 9 | Chlamydiatrachomatis | VR-878 | Lysate | 9.3E + 06IFU / mL | nucleata sample strain
23 Mobiluncus curtisii 35241 Lysat SE + 11 copies Ke PP eat Ot tenen OO ES
(Finegoldia magna)
37 Ureaplasma urealyticum 27618 Lysate 4,1E + 11 copies Ke TOR | on PE Ve eserotype IV
43 Streptococcus agalactiae type of
The ee Strains 38-43 returned positive signals in the FAM channel, while the other strains returned only IC signals in the RED channel.
Example 5 BE2019 / 5528 The performance of the primer / probe combination 3, targeting only the SIP gene to GBS, was compared to that of the primer / probe combinations 3 and 17 (as multiplex reaction), targeting the S / P and CFB genes, respectively.
Different concentrations of GBS primers / probes were tested on a GBS strain enriched in sample transport medium (STM) at 3000 CFU / PCR, using the ABI 7500 FAST Real PCR system. Time after extraction from the KINGFISHERM system.
Nucleic acid isolation, amplification and detection reactions were performed generally as described above.
No significant difference in Ct values was observed between the SIP-only primer / probe set and the S / P / CFB primer / probe set, while the endpoint fluorescence level was higher using the multiplexed SIP / CFB primer / probe set compared to the S / P primer / probe set.
Example 6 A preliminary study was performed to determine the limit of detection (LoD) of multiplexed SIP / CFB primer / probe combinations 3 and 17 on serotype III to GBS (from ATCC) using '' a Probit analysis (Minitab® 17 software). The GBS III strain serotype was serially diluted in Lim Broth to eight concentrations (based on plating): 20,000.0, 10,000.0, 5,000.0, 2,500.0, 1,250.0 , 625.0, 312.5 and 156.3 CFU / mL, from a previous culture of GBS (stock solution in sample transport medium (STM)). These eight dilutions were added to the corresponding sample tubes as follows: 250.0 uL of sample in 750.0 uL of transfer solution (the transfer solution being a mixture of STM + Target Capture Oligo (TCO) (at 1667 pmol / 750 uL STM). Due to the final 1: 4 dilution in the sample tube, the final concentrations were 5,000.0, 2,500.0, 1,250.0, 625.0, 312.5 , 156.3, 78.1 and 39.1 CFU / mL.
Each dilution was tested in 20 extractions and one PCR replicate, on two assays on the PANTHER FUSION® System. A positive control (mixture of S / P and CFB plasmids to GBS at 141 and 781 c / µL in STM) and a negative control (Lim Broth) were also tested in one or two extraction replicates and one PCR replicate, respectively .
Probit analysis was performed on the basis of the concentrations tested, the number of positive calls and the number of tests obtained per concentration, using the software
Minitab® 17. BE2019 / 5528 Three distribution modes were compared (LogNormal, Weibull and LogLogistic) and the one that gave the best p-values, i.e., close to 0.000 for the regression table and the most nearly 1,000 for goodness-of-fit testing, was chosen, as summarized in Table 17 below.
Based on this table, the Weibull distribution mode was used for the determination of the detection limit.
Table 17 Regression table (P value) (should 0.000 0.000 0.000 be = 0.000),,; Ee os goodness-of-fit testing | 0m | om be = 1.000) 0.966 0.999 0.893 The results obtained on the PANTHER FUSION system are summarized in Table 18 below.
The last dilution has been removed from the statistical analysis.
Table 18 CFU / mL SD Value% Calls SD Value% Average Ct Positive Average Valid (FAM) Ct (Red677) 200000 | 333 108] 100 | 315 [04] 100 | 10,000.0 5,000.0 2,500.0 1,250.0 625.0 312.5 | 389 10.8] 40 | 34 103] 100 | The limit of detections "of the GBS III serotype was found to be 1,294 CFU / mL in LB, or 324 CFU / mL in the sample tested.
Example 7 BE2019 / 5528 Analytical sensitivity and inclusiveness using the SIP 3 primer / probe combination multiplexed with the CFB 17 primer / probe combination was assessed by the serial dilution test of Cell lysates in Lim Broth negative clinical matrix for GBS serotypes Ia, Ib, Ic, IL, HI, IV, V, VI, VII, VIII and IX.
In addition, a non-hemolytic (NH) strain was evaluated.
The 95% detection limit of the PANTHER FUSION® GBS assay for each serotype was determined using Probit regression analysis and predicted detection limits were confirmed in all 12 GBS serotypes.
Microorganism cross-reactivity and interference were evaluated with 45 bacterial or fungal species, with and without the presence of the GBS III serotype at 3x the limit of detection.
A process comparative study was performed by testing Lim Broth spiked specimens (n = 255) from antepartum women undergoing GBS culture screening to standard of care at two different hospitals.
Culture sensitivity and specificity were determined for the GBS test by PANTHER FUSION.
Samples showing discordant results were tested with the GBS test by BDMax.
All tests were performed on the PANTHER FUSION System.
Sensitivity and analytical inclusiveness.
Panels were created by adding lysate stocks of known UFC / mL concentrations into the Lim Broth Enrichment Matrix.
Each panel was tested in replicates of 30 with each of the three test reagent lots using three PANTHER FUSION systems.
The detection limits of 50% and 95% were estimated for each strain and lot of reagents by Probit assay (see Table 19 below). The detection limits are shown in Table 19 in CFU / mL in the Lim Broth sample (recalculated from CFU / mL in the test sample by PANTHER FUSION, i.e. 1: 4 dilutions of Lim Broth in sample transport medium (STM)). A confirmatory test of the predicted detection limits was performed and a positivity of at least 95% was observed for all serotypes.
Table 19 BE2019 / 5528
GHG 50% of 95% limit 50% of 95% limit | 50% limit | 95% of limit of detection limit of detection of detection of detection of detection (95% of CD detection (95% of CD (95% of CD (95% of CD (95% of CD in CFU / mL (95% of CD in CFU / mL in CFU / mL in CFU / mL in CFU / mL in CFU / mL 36.50 137.37 26.36 123.33 35.63 109.16 (28.67 to (103.68 to (19.74 to (89.18 to (28.67 to 43.02) (84.84 to 44.79) 209.68) 33.39) 202.93) 149.26) 27.67 140.47 28.51 104.35 25.24 116.49 (20.47 to (100.59 to (22.08 to (78.89 to (18.81 to 32.05) (84.69 to 35.27) 234.73) 35.26) 158.81) 189.07) (40.74 to (85.36 to (29.27 to (91.78 to (22.45 to 37.26) (99.20 to 55.65) 143.01) 44.21) 177.29) 220.52) 49.95 179.02 37.71 152.98 41.91 154.27 (40.31 to (135.06 to (29 , 45 to (113.83 to (33.35 to 51.08) (116.64 to 60.41) 276.19) 46.50) 239.70) 214.66) 42.71 168.00 34, 51 162.49 33.28 109.63 (33.94 to (125.20 to (26.60 to (117.01 to (26.54 to 40.53) (84.15 to 52.32) 261, 50) 43.19) 268.11) 162.56) IV 26.35 83.97 21.61 72.93 23.38 70.13 (18.89 to (63.02 to (16.66 to (54 , 81 to (18.44 to 28.67) (53.84 to 32, 96) 130.42) 26.88) 113.53) 105.00) (25.70 to (92.24 to (25.75 to (66.53 to (17.34 to 28.71) (65, 55 to 40.38) 186.80) 38.13) 121.30) 138.81) VI 63.46 281.95 56.34 265.87 49.18 216.19 (50.73 to (201.92 to (44.56 to (189.40 to (38.97 to 60.64) (157.14 to 78.03) 475.82) 69.76) 449.57) 351.40) VII 57.96 250 , 80 41.29 182.99 29.36 160.87 (46.30 to (180.16 to (32.01 to (133.94 to (21.38 to 37.65) (113.94 to 71, 06) 424.80) 51.16) 295.79) 275.73) VIII 44.28 220.54 51.86 231.27 38.63 192.88 Tee és PTT 55.34) 370.98) 63, 93) 380.88) 322.17) IX 46.72 300.99 35.36 186.19 29.29 137.93 (35.16 to (202.02 to (26.76 to (131.87 to ( 21.95 to 37.01) (100.34 to 59.69) 567.73) 44.70) 316.56) 223.89) NH 63.97 300.17 57.05 227.01 54.15 192 , 88 (50.75 to (211.99 to (45.71 to (167.33 to (43.74 to 65.30) (145.53 to 78.99) 522.99) 69.43) 366, 40) 299.61) Cross-reactivity and interference from microorganisms. The bacterial and fungal species shown in Table 20 below were introduced into the Lim Broth negative matrix at a concentration of 1e6 CFU / mL in the test sample. Panels were tested with and without GBS serotype III, at 3x the estimated limit of detection. Each panel was tested in triplicate with a lot of test reagents. No cross-reactivity was observed in panels lacking GBS target. No interference was observed in panels containing the GBS target.
Table 20: organisms tested BE2019 / 5528 Acinetobacter iwoffii Proteus vulgaris Actinomycesisraelii Alcaligenesfaecalis Staphylococcus aureus Bifidobacterium adolescentis Staphylococcus epidermidis Campylobacter jejuni Streptococcus pyogenes Candida albicans Streptococcus anginosus Clostridium difficile Streptococcus bovis Corynebacterium genitalium Streptococcus gordonii Cryptococcus neoformans Streptococcus mitis Enterobacter cloacae Streptococcus mutans Enterococcus faecalis Streptococcus oralis Escherichia coli Streptococcus parasanguinis Fusobacterium necleatum Gardnerella vaginalis Streptococcus pneumoniae Streptococcus acidominimus Haemophilusducreyi Streptococcus canis Klebsiella pneumoniae Streptococcus cricetus Lactobacillus acidophilus Streptococcus cristatus Lactobacilluscrispatus Streptococcus downei Listeria monocytogenes Streptococcus dysagalactiae Streptococcus equi Peptostreptococcusmagnus Streptococcus ratti Prevolellabivia Streptococcus costellatus Propionibacterium acnes LU.
Comparison of processes.
A total of 255 vaginal-rectal swabs were collected from women before delivery, following guidelines recommended by the CDC.
Each sample was spiked at 35-37 ° C for 18-24 hours in Lim Broth medium.
Each sample was evaluated using a reference culture and tested in the GBS assay by PANTHER FUSION.
Clinical sensitivity and specificity were determined based on the result of the reference culture.
The results are summarized in Table 21 below.
The sensitivity and specificity of the PANTHER FUSION GBS test were 100% and 98.6%, respectively. There were three positive samples for the negative culture PANTHER FUSION GBS test, all of which the repeated PANTHER FUSION GBS test gave positive results.
A second molecular test method, the BDMax GBSassay, was used to analyze the discordant samples, and GBS was detected in all three samples.
Table 21 BE2019 / 5528 Reference culture | + | + GBS test by PANTHER 209
FUSION Sensitivity (95% CI): 100% (91.8 to 100) Specificity (95% CI): 98.6% (95.9 to 99.5) Culture prevalence: 16.9% Prevalence by Panther Fusion: 18.0% Conclusions. Preliminary analytical studies showed that the assay exhibited consistent detection of GBS among the serotypes tested, and the comparison with culture methods showed that the assay had high sensitivity and specificity. Example 8 This example describes the evaluation of the analytical specificity of the S / P 3 primer / probe combination multiplexed with the CFB 17 primer / probe combination on the PANTHER FUSION® Automated System.
A panel of 124 organisms consisting of 104 bacterial strains, 12 viral, 4 yeast / fungi and 4 protozoan / parasitic strains representing microorganisms commonly found in the vaginal / anal flora or belonging to the same family / genus as GBS have were chosen for analytical specificity tests. The analytical specificity panel is detailed in Table 22. Of the 124 organisms chosen, 14 were not available to be tested at the time of the study.
Potential cross-reactivity with the primers and probes of the GBS assay for these 14 unavailable organisms was assessed by BLAST analysis with no alignment identified. The analytical specificity was assessed using the following two approaches: (1) Cross-reactivity (exclusivity): check if these organisms cross-react with the primers and probes of the GBS test and induce a false positive result in the confirmed negative GBS samples; (2) Microbial interference: To determine if these organisms could interfere with the normal detection of GBS in samples positive for GBS at a concentration near the limit of detection.
Groups consisting of five (5) microorganisms were diluted in sample transport medium (STM) at high concentrations (minimum 10 ° CFU / mL for BE2019 / 5528 bacteria and yeasts and 105 PFU / mL for virus or its virus. equivalent). The group composition is detailed in Table 22. For evaluation of cross-reactivity (propriety), these groups of microorganisms were added to clinical Lim Broth matrix samples negative (GBS negative samples). For the assessment of microbial interference, these groups of microorganisms were added to negative Lim Broth matrix clinical samples enriched with GBS serotype III at 3 detection limits (GBS positive samples). For each group of microorganisms to be tested, three replicate positive and negative GBS samples were tested for the PANTHER FUSION GBS test and the data shown. Acceptance Criteria: (1) For a (group of) microorganism (s) to be considered non-cross-reactive, the three negative Lim Broth matrix clinical specimen replicates (specimens negative GBS) must be declared negative; (2) In order for a (group of) microorganism (s) to be considered non-interfering, the three replicates of a positive GBS serotype III sample (GBS positive samples) must be declared positive.
Table 22: Concentrati Concentra Mi analytical specificity panel; on G Mi; tion G icroorganism (CFU / mL rou icroorganism (CFU / mL rou or pe or pe UEP / mL *) UEP / mL *) Yersinia enterocolitica subsp. 1x 106 Prevotella oralis 1 x 106 enterocolitica I XII Propionibacterium acnes 1x 106 Lactobacillus delbrueckii 1 x 106 subsp. lactis Clostridium difficile 1x 106 Corynebacterium sp 1 x 106 (genitalium)
Concentrati Concentra BE2019 / 5528 Mi; on G Mi; tion G Microorganism (CFU / mL brou Microorganism (CFU / mL & rou or pe or pe UEP / mL *) UEP / mL *) Bifidobacterium adolescentis 1x 106 Streptococcus pneumoniae 1 x 106 Reuter I {oral group) XII Candida albicans (NIH 3147) 1x 106 Streptococcus mutans 1 x 106 (oral group) Candida glabrata (CBS 138) Corynebacterium urealyticum Candida tropicalis Lactobacillus reuteri Cryptococcus neoformans Lactobacillus sp.
Klebsiella pneumoniae Lactobacillus casei
EU [Lactobacillus acidophilus XIN
Alcaligenes faecalis 1 x 10 ° Streptococcus gordonii 1 x 10 ° (oral group)
Bulkholderia cepacia Stenotrophomonas maltophilia Aeromonas hydrophila Campylobacter jejuni Moraxella atlantae
1V [Prevotella bivia XV
Pasteurella aerogenes Staphylococcus haemolyticus Rhodococcus equi
V | Lactobacillus gasseri XVI Staphylococcus saprophyticus 1x 106 Peptoniphilus 1 x 106asaccharolyticus Toxoplasma gondii 1 x 105 * Bifidobacterium brevis Escherichia coli Morganella morganii 1x 106 Peptostreptococcus 1 x 106 anaerobius Shigella flexnerolyticus 1 x 10 6 human HeroccyticusVirus 1 x StreoccytusVusVirus 1 x human heroccyticusVusVirus 1 x LactocusVus 1 x Escherichia coli Morganella morganella coli 1 x 106 Shigella flexella 1 x LactocusVocusVocus 1 x LactocusVus 1 1 x 10 1x 10 ° * (group A)
VI | Bacteroïdes fragilis AM Staphylococcus lugdunensis Bordetella pertussis
Chlamydia trachomatis Staphylococcus aureus Human herpesvirus 5 (CMV) Shigella sonnei Trichomonas vaginalis Citrobacter freundii 1 x 10 ° VIII Immunodeficiency virus 1 x 105: XIXhuman 1 (HIV-1) Enterococcus gallinarum Moraxella catarrhalii Acinetobacter lwoffasmaium
Rubella virus
Haemophilus infuonzae x xx
Concentrati Concentra BE2019 / 5528 Mi; on G Mi; tion G Microorganism (brou Microorganism (Grou icroorganism UFC / mL rou icroorganism UFC / mL rou or pe or pe UEP / mL * UEP / mL * Klebsiella oxytoca Streptococcus bovis (group D) | 1x 105 Human papillomavirus | 1 x 105 : type 16 (HPV16) Streptococcus parasanguinis Hepatitis B virus Streptococcus equi subsp. equi 1 x 106 Hepatitis C virus 1 x 10 ° * (group D) Enterococcus durans 1 x 106 X Herpes simplex virus - 1 1 x 10 ° * XXI (HSV-1) Lactobacillus plantarum 1x 106 Herpes simplex-2 virus 1 x 10 ° (HSV-2) Streptococcus dysgalactiae Human herpesvirus 3 (VZV) Streptococcus constellatus Arcanobacterium pyogenes Streptococcus oralis (group 1x 106 Mobiluncus curtisii subsp 1x 106 oral) XI curtisii XXII Bacillus coagulans Gardnerella vaginalis Streptococcus pseudoporcinus 1x 106 Salmonella enterica 1x 106 subsp.enterica ser. Dublin (group D) Streptococcus mitis 1 x 106 Streptococcus acidominus 1 x 106 (oral group) * genomic extracts , concentration expressed in c / mL Micr oorganisms assessed by BLAST analysis Actinomyces israelii Pantoea agglomerans Human immunodeficiency virus-2 (HIV-2) Actinobacillus pleuropneumoniae | Staphylococcus simulans Parvovirus B19 Haemophilus ducreyi Lactobacillus crispatus Mycoplasma hominis Ureaplasma urealyticum | Study results.
The analysis was valid and the internal control (IC) was detected in each reaction, resulting in an invalid analysis rate and a 0% invalidity rate, respectively.
All negative GBS samples tested for the evaluation of cross-reactivity gave valid and negative results with the primers and GBS probes on the PANTHER FUSION System, while all the positive GBS samples tested for the evaluation of microbial interference gave positive GBS results with the PANTHER FUSION GBS test.
The results are shown in Table 23 below.
Table 23: results of analytical specificity BE2019 / 5528 eee ee
SEQUENCE BE2019 / 5528 Table 24: Examples of sequences of oligomers, reference sequences and regions SEQ ID Description Sequence (5 '> 3') NO: 1 Sequence of ATGAAAATGAATAAAAAGGTACTATTGACATCGACAATGGCAGCTT reference CGCTATTATCAGTCGCAAGTGTTCAAGCACAAGAAACAGATACGAC corresponding to GTGGACAGCACGTACTGTTTCAGAGGTAAAGGCTGATTTGGTAAAG gene SIP CAAGACAATAAATCATCATATACTGTGAAATATGGTGATACACTAA Streptococcus agalactiae GCGTTATTTCAGAAGCAATGTCAATTGATATGAATGTCTTAGCAAA (GBS) AATTAATAACATTGCAGATATCAATCTTATTTATCCTGAGACAACA CTGACAGTAACTTACGATCAGAAGAGTCACACTGCCACTTCAATGA AAATAGAAACACCAGCAACAAATGCTGCTGGTCAAACAACAGCTAC TGTGGATTTGAAAACCAATCAAGTTTCTGTTGCAGACCAAAAAGTT TCTCTCAATACAATTTCGGAAGGTATGACACCAGAAGCAGCACCAA CGATTGTTTCGCCAATGAAGACATATTCTTCTGCGCCAGCTTTGAA ATCAAAAGAAGTATTAGCACAAGAGCAAGCTGTTAGTCAAGCCGCA GCTAATGAACAGGTATCACCAGCTCCTGTGAAGTCGATTACTTCAG AAGTTCCAGCAGCTAAAGAGGAAGTTAAACCAACTCAGACGTCAGT CAGTCAGTCAACAACAGTATCACCAGCTTCTGTTGCCACTGAAACA CCAGCTCTAGTAGCTAAAGTAGCACCGGTAAGAACTGTAGCAGCCC CTAGAGTGACAAGTGCTAAAGTAGTCACTCCTAAAGTAGAAACTGG TGCATCACCAGAGCATGTATCAGCTCCAGCAGTTCCTGTGACTACG ACTTCAACAGCTACAGACAATAAGTTACAAGCGACTGAAGTTAAGA GCGTTCCGGTAGCACAAAAAGCTCCAACAGCAACACCGGTAGCACA ACCAGCTTCAACAACAAATGCAGTAGCTGCACATCCTGAAAATGCA GGGCTCCAACCTCATGTTGCAGCTTATAAAGAAAAAGTAGCGTCAA CTTATGGAGTTAATGAATTCAGTACATACCGTGCGGGAGATCCAGG TGATCATGGTAAAGGTTTAGCAGTTGACTTTATTGTAGGTACCAAT CAAGCACTTGGTAATGAAGTTGCACAGTACTCTACACAAAATATGG CAGCAAATAACATTTCATATGTTATCTGGCAACAAAAGTTTTACTC AAATACAAATAGTATTTATGGACCTGCTAATACTTGGAATGCAATG CCAGATCGTGGTGGCGTTACTGCCAACCACTATGACCACGTTCACG
TATCATTTAACAAATAA 2 Sequence ATGAACGTTAAACATATGATGTATCTATCTGGAACTCGAGTGGCTG reference GTGCATTGTTATTTTCACCAGCTGTATTAGAAGTACATGCTGATCA corresponding to AGTGACAACTCCACAAGTGGTAAATCAAGTAAATAGTAATAATCAA gene CFB (factor GCCCAGCAAATGGCTCAAAAGCTTGATCAAGATAGCATTCAGTTGA cAMP) to GAAATATCAAAGATAATGTTCAGGGAACAGATTATGAAAAACCGGT Streptococcus TAATGAGGCTATTACTAGCGTTGAAAAATTAAAGACTTCATTGCGT agalactiae (GBS) GCCAACCCTGAGACAGTTTATGATTTGAATTCTATTGGTAGTCGTG TAGAAGCCTTAACAGATGTGATTGAAGCAATCACTTTTTCAACTCA ACATTTAACAAATAAGGTTAGTCAAGCAAATATTGATATGGGATTT GGGATAACTAAGCTAGTTATTCGCATTTTAGATCCATTTGCTTCAG TTGATTCAATTAAAGCTCAAGTTAACGATGTAAAGGCATTAGAACA AAAGGTTTTAACTTATCCTGATTTAAAACCAACTGATAGAGCTACC ATCTACACAAAATCAAAACTTGATAAGGAAATTTGGAATACACGTT TTACTAGAGATAAAAAAGTACTTAACGTCAAAGAATTTAAAGTTTA CAATACTTTAAATAAAGCAATCACACATGCTGTTGGAGTTCAGTTG AATCCAAATGTTACGGTACAACAAGTTGATCAAGAGATTGTAACAT
TACAAGCAGCACTTCAAACAGCATTAAAATAAge ABD SEQ ID Description Sequence (5 '> 3') 19/5528 NO: Reverse primer SIP | AACGCTTAGTGTATCACCATAT primer before CGGTAAGAACTGTAGCAGCC SIP 6 SIP Reverse Primer | GCTCTTAACTTCAGTCGCTTG primer before SIP AACAAATGCTGCTGGTCAAA 8; Reverse Primer SIP | AGAATATGTCTTCATTGGCGAA probe detection SIP ACTGTTTCAGAGGTAAAGGCTGATTTGGTAAAGC probe GCTCCAGCAGTTCCTGTGACTACGACTTC detection SIP 11 probe CGGAAGGTATGACACCAGAAGCAGCA detection SIP primer before SFBC GTGGCTGGTGCATTGTTATTT 13 Primer reverse CCATTTGCTGGGCTTGATTATT CFB forward primer CFB TAGTGGCTGGTGCATTGTT Primer reverse CATTTGCTGGGCTTGATTATTACT CFB forward primer CFB CTGGAATACACGCTTTACTAGAGATA 17 Primer reverse ACTTGTTGTACCGTAACATTTGG CFB forward primer CFB TATCTATCTGGAACTCTAGTGGCT primer before SFBC CAAAGATAATGTTCAGGGAACAGA 21 Primer reverse GCTTCTACACGACTACCAATAGA SFBC 22 CFB detection ACCACTTGTGGAGTTGTCACTTGATCAGC probe 23 CFB detection CAAGTGACAACTCCACAAGTGGTAAATCATGT probe 24 AGCAATCACACATGCTGTT probe GGAGTTCAGT detection CFB TTGCGTGCCAACCCTGAGACAGTTTA detection CFB 26 Region TATCTATCTGGAACTCTAGTGGCTGGTGCATTGTTATTT for hybridization of CFB oligomers 27 TAGTGGCTGGTGCATTGTTATTTGGTBGoligere CFCTBoligerization GTBGTGCATTGTTATTTGTBGoligeree GTBGoligerization Sequence 28 TAGGGoligere CFCTGTTGTTATTTGTTGoligere hybridization sequence
From the foregoing, it will be appreciated that although specific embodiments of the invention have been described in the present invention for purposes of illustration, various modifications can be made without departing from the practice. spirit and scope of the invention.
Accordingly, the invention is limited only by the appended claims.
All publications, patents and patent applications cited in the present invention are incorporated by reference in their entirety for all convenience.

权利要求:
Claims (231)
[1]
1. Composition intended to determine the presence or absence of group B streptococci (GBS) in a sample, said composition comprising: a first combination of amplification oligomers and / or a second combination of amplification oligomers, wherein (D the first combination of amplification oligomers comprises first and second S / P specific amplification oligomers capable of amplifying a target region of a S / P target nucleic acid to GBS, wherein the first and second PBS specific amplification oligomers comprise, respectively, first (A) and second (B) S / P specific target hybridization sequences selected from the group consisting of (a) (A) SEQ ID NO: " 3, or RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 4, or RNA equivalent or DNA / RNA chimera thereof ; and (b) (A) SEQ ID NO: 7, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 8, or an equi are RNA or a DNA / RNA chimera thereof; and (ID the second combination of amplification oligomers comprises first and second CFB-specific amplification oligomers capable of amplifying a target region of a CFB-to-GBS target nucleic acid, wherein the first and second oligomers of CFB-specific amplifications comprise, respectively, first (A) and second (B ”) CFB-specific target hybridization sequences selected from the group consisting of (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID No: 26, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 13 or SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; (b) (A ") SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera of this one, and
(B) SEQ ID NO: 17, or an RNA equivalent or DNA / RNA chimera of BE2019 / 5528 thereof; (c) (A) SEQ ID No: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (d) (A ") SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
[2]
2. The composition of claim 1, wherein the first and second target hybridization sequences specific to SIP are the target hybridization sequences of (I) (a).
[3]
3. The composition of claim 1, wherein the first and second S7P-specific target hybridization sequences are the target hybridization sequences of (I) (b).
[4]
The composition of any one of claims 1 to 3, wherein if said composition comprises the first combination of amplification oligomers, then said composition further comprises an S / P specific detection probe oligomer comprising a S / P-specific detection probe target hybridization sequence that is about 15 to about 35 nucleotides in length and that is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and third parties. second amplification oligomers specific to S / P.
[5]
The composition of claim 4, wherein the first and second S7P-specific target hybridization sequences are the target hybridization sequences of (I) (a) and the SIP-specific detection probe target hybridization sequence. is SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof.
[6]
The composition of claim 4, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (I) (b) and the SIP-specific detection probe target hybridization sequence. is SEQ ID NO: 11, or an RNA equivalent or DNA / RNA chimera thereof.
[7]
7. The composition of any one of claims 4 to 6, wherein BE2019 / 5528 the S / P specific detection probe oligomer further comprises a detectable label.
[8]
8. The composition of claim 7, wherein the detectable label is a fluorescent or chemiluminescent label.
[9]
9. The composition of claim 7, wherein the detectable label is a fluorescent label and the S / P specific detection probe oligomer further comprises a non-fluorescent quencher.
[10]
10. The composition of any one of claims 1 to 9, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (ID (b).
[11]
11. The composition of any one of claims 1 to 9, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID (d).
[12]
12. The composition of any one of claims 1 to 9, wherein the target hybridization sequences specific to CFB are the target hybridization sequences of (ID) (a).
[13]
13. The composition of claim 12, wherein the first CFB-specific target hybridization sequence of (IT) (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a chimera d. DNA / RNA thereof.
[14]
14. The composition of claim 13, wherein the first CFB-specific target hybridization sequence of (II) (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or a chimera d. DNA / RNA thereof.
[15]
15. The composition of claim 14, wherein the first CFB-specific target hybridization sequence of (II) (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or a chimera. DNA / RNA thereof.
[16]
16. The composition of claim 12, wherein the first CFB-specific target hybridization sequence BE2019 / 5528 of (ID) (a) is SEQ ID NO: 18, or an equivalent of RNA or a DNA chimera. / RNA of it.
[17]
17. The composition of claim 12, wherein the first (A ") and second (B ') CFB-specific target hybridization sequences of (ID) (a) are selected from the group consisting of (1) (A). SEQ ID NO: 12, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 13, or an RNA equivalent or a DNA chimera / RNA thereof; (ii) (A) SEQ ID NO: 12, or an RNA equivalent or DNA / RNA chimera thereof, and (B ') SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof; (c) (A ") SEQ ID NO: 14, or an RNA equivalent or a DNA / RNA chimera thereof; ci, and (B ') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and (iv) (A ") SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof.
[18]
18. The composition of any one of claims 1 to 9, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (ID) (c).
[19]
19. The composition of any one of claims 1 to 18, wherein if said composition comprises the second combination of amplification oligomers, then said composition further comprises a CFB-specific detection probe oligomer comprising a sequence of. Target hybridization of a CFB-specific detection probe that is about 15 to about 35 nucleotides in length and that is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second amplification oligomers specific to CFB. CFB.
[20]
20. The composition of claim 19, wherein the first and second BE2019 / 5528 CFB-specific target hybridization sequences are the target hybridization sequences of (ID (b) and the target specific detection probe hybridization sequence. to CFB is SEQ ID NO: 24, or an RNA equivalent or DNA / RNA chimera thereof.
[21]
21. The composition of claim 19, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (d) and the target hybridization sequence of CFB-specific detection probe. is SEQ ID NO: 25, or an RNA equivalent or DNA / RNA chimera thereof.
[22]
22. The composition of claim 19, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (I) (a) and the CFB-specific detection probe target hybridization sequence. is SEQ ID NO: 22 or SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[23]
23. The composition of claim 19, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (c) and the target hybridization sequence of CFB-specific detection probe. is SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[24]
24. The composition of any of claims 19 to 23, wherein the CFB-specific detection probe oligomer further comprises a detectable label.
[25]
25. The composition of claim 24, wherein the detectable label is a fluorescent or chemiluminescent label.
[26]
26. The composition of claim 24, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[27]
27. A composition according to any one of claims 1 to 26, wherein said composition comprises both the first and second combinations of amplifying oligomers.
[28]
28. A composition for determining the presence or absence of BE2019 / 5528 group B streptococci (GBS) in a sample, said composition comprising: a combination of amplification oligomers comprising first and second amplification oligomers specific to S / P capable of amplifying a target region of a SIP to GBS target nucleic acid, wherein the first and second SIP specific amplification oligomers comprise, respectively, first (A) and second (B) sequences of hybridization specific targets to S / P selected from the group consisting of (a) (A) SEQ ID NO: "3, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 4, or an equivalent of RNA or a DNA / RNA chimera thereof; and (b) (A) SEQ ID NO: 7, or an equivalent of RNA or a chimera of DNA / RNA thereof, and (B) SEQ ID NO: 8, or an RNA equivalent or DNA / RNA chimera thereof.
[29]
29. The composition of claim 28, wherein the first and second target hybridization sequences specific to SIP are the target hybridization sequences of (a).
[30]
30. The composition of claim 28, wherein the first and second target hybridization sequences specific to SIP are the target hybridization sequences of (b).
[31]
31. The composition of any one of claims 28 to 30, wherein said composition further comprises an S / P-specific detection probe oligomer comprising an S / P-specific detection probe target hybridization sequence. which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second S / P specific amplification oligomers.
[32]
32. The composition of claim 31, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (a) and the SIP-specific detection probe target hybridization sequence is SEQ ID No: 9, or an RNA equivalent or DNA / RNA chimera thereof.
[33]
33. The composition of claim 32, wherein the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (b) and the SIP-specific detection probe target hybridization sequence is. SEQ ID NO: 11, or an RNA equivalent BE2019 / 5528 or a DNA / RNA chimera thereof.
[34]
34. The composition of any of claims 31 to 33, wherein the detection probe oligomer further comprises a detectable label.
[35]
35. The composition of claim 34, wherein the detectable label is a fluorescent or chemiluminescent label.
[36]
36. The composition of claim 34, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[37]
37. The composition of any one of claims 28 to 36, further comprising a second combination of amplifying oligomers capable of amplifying a target region of a target nucleic acid CFB to GBS.
[38]
38. A composition for determining the presence or absence of group B streptococci (GBS) in a sample, said composition comprising: a combination of amplification oligomers comprising first and second CFB-specific amplification oligomers capable of '' amplify a target region of a CFB to GBS target nucleic acid, wherein the first and second CFB specific amplification oligomers comprise, respectively, first (A) and second (B) CFB specific target hybridization sequences , the first target hybridization sequence consisting of a sequence selected from (a) (A), (b) (A), (c) (A), or (d) (A) and the second target hybridization sequence consisting of a sequence selected from (a) (B), (b) (B), (c) (B) or (d) (B) respectively, in which (a) (A) (B), (b) (A) (B) and (c) (A) (B) and (d) (A) (B) are as follows: (a) (A) SEQ ID No: 12 or SEQ ID No 14, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID No: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; (b) (A) SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof;
(c) (A) SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (d) (A) SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
[39]
39. The composition of claim 38, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (b).
[40]
40. The composition of claim 38, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d).
[41]
41. The composition of claim 38, wherein the target hybridization sequences specific to CFB are the target hybridization sequences of (a).
[42]
42. The composition of claim 41, wherein the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a DNA chimera. / RNA of it.
[43]
43. The composition of claim 42, wherein the first CFB-specific target hybridization sequence of (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or DNA chimera. / RNA of it.
[44]
44. The composition of claim 43, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or a chimera of. DNA / RNA thereof.
[45]
45. The composition of claim 41, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof. .
[46]
46. The composition of claim 41, wherein the first (A) and second (BBE201 9/5528 CFB-specific target hybridization sequences of (a) are selected from the group consisting of () (A) SEQ ID NO: : 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 13, or an equivalent of RNA or a DNA / RNA chimera thereof, ci; (ii) (A) SEQ ID NO: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; (iii) (A) SEQ ID NO: 14, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (iv) (A) SEQ ID NO: 18, or an equivalent of RNA or a chimera d DNA / RNA thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof.
[47]
47. The composition of claim 38, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (c).
[48]
48. The composition of any one of claims 38 to 47, wherein said composition further comprises a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence which has a length. of about 15 to about 35 nucleotides and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB-specific amplification oligomers.
[49]
49. The composition of claim 48, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b) and the CFB-specific detection probe target hybridization sequence is SEQ ID No: 24, or an RNA equivalent or DNA / RNA chimera thereof.
[50]
50. The composition of claim 48, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d) and the CFB-specific detection probe target hybridization sequence is SEQ ID N °: 25, or an RNA equivalent BE2019 / 5528 or a DNA / RNA chimera thereof.
[51]
51. The composition of claim 48, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 22 or SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[52]
52. The composition of claim 48, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c) and the CFB-specific detection probe target hybridization sequence is SEQ ID No: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[53]
53. A composition according to any one of claims 48 to 52, wherein the detection probe oligomer further comprises a detectable label.
[54]
54. The composition of claim 53, wherein the detectable label is a fluorescent or chemiluminescent label.
[55]
55. The composition of claim 53, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[56]
56. The composition of any of claims 38 to 55, further comprising a second combination of amplifying oligomers capable of amplifying a target region of a target nucleic acid S / P to GBS.
[57]
57. Kit intended for determining the presence or absence of group B streptococci (GBS) in a sample, said composition comprising: a first combination of amplification oligomers and / or a second combination of amplification oligomers, wherein (D the first combination of amplification oligomers comprises first and second S / P specific amplification oligomers capable of amplifying a target region of a S / P target nucleic acid to GBS, wherein the first and SIP-specific amplification second oligomers comprise, respectively, BE2019 / 5528 first (A) and second (B) S / P-specific target hybridization sequences selected from the group consisting of (a) (A) SEQ ID N ° "3, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 4, or an equivalent of RNA or a DNA / RNA chimera thereof, here; and (b) (A) SEQ ID NO: 7, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 8, or an eq uivalent of RNA or a DNA / RNA chimera thereof; and (ID the second combination of amplification oligomers comprises first and second CFB-specific amplification oligomers capable of amplifying a target region of a CFB-to-GBS target nucleic acid, wherein the first and second oligomers of CFB-specific amplifications comprise, respectively, first (A) and second (B ”) CFB-specific target hybridization sequences selected from the group consisting of (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID No: 26, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 13 or SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; (b) (A) SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera thereof; here, and (B ') SEQ ID No: 17, or an RNA equivalent or a DNA / RNA chimera thereof; (c) (A ") SEQ ID No: 18, or a RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and (d) (A ") SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
[58]
58. The kit of claim 57, wherein the first and second SP-specific target hybridization sequences are the target hybridization sequences of (D) (a).
[59]
59. The kit of claim 57, wherein the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (I) (b).
[60]
60. The kit of any one of claims 57 to 59, wherein if the kit comprises the first combination of amplification oligomers, then said kit further comprises a SIP-specific detection probe oligomer comprising a sequence of. target hybridization of specific detection probe to S / P that is about 15 to about 35 nucleotides in length and that is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second oligomers of amplification specific to SIP.
[61]
61. The kit of claim 60, wherein the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (I) (a) and the target specific detection probe hybridization sequence. to SIP is SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof.
[62]
62. The kit of claim 60, wherein the first and second SZP-specific target hybridization sequences are the target hybridization sequences of (I) (b) and the SIP-specific detection probe target hybridization sequence. is SEQ ID NO: 11, or an RNA equivalent or DNA / RNA chimera thereof.
[63]
63. The kit of any one of claims 60 to 62, wherein the SIP-specific detection probe oligomer further comprises a detectable label.
[64]
64. Kit according to claim 63, in which the detectable label is a fluorescent or chemiluminescent label.
[65]
65. The kit of claim 63, wherein the detectable label is a fluorescent label and the S / P specific detection probe oligomer further comprises a non-fluorescent quencher.
[66]
66. A kit according to any one of claims 57 to 65, wherein the first and BE2019 / 5528 second CFB specific target hybridization sequences are the target hybridization sequence of (ID (b).
[67]
67. The kit of any one of claims 57 to 65, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID (d).
[68]
68. The kit of any one of claims 57 to 65, wherein the CFB specific target hybridization sequences are the target hybridization sequences of (ID (a).
[69]
69. The kit of claim 68, wherein the first CFB-specific target hybridization sequence of (II) (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a chimera d DNA / RNA thereof.
[70]
70. The kit of claim 69, wherein the first CFB-specific target hybridization sequence of (ID) (a) is present in the sequence of SEQ ID NO: 27, or an equivalent of RNA or a chimera d. DNA / RNA thereof.
[71]
71. The kit of claim 70, wherein the first CFB-specific target hybridization sequence of (IT) (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or a chimera. DNA / RNA thereof.
[72]
72. The kit of claim 68, wherein the first CFB-specific target hybridization sequence of (ID) (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera of. this one.
[73]
73. Kit according to claim 68, wherein the first (A ") and second (B ') target hybridization sequences specific to CFB of (II) (a) are chosen from the group consisting of () (A) SEQ ID NO: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 13, or an equivalent of RNA or a DNA / RNA chimera of it;
(ii) (A) SEQ ID NO: 12, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A ") SEQ ID No: 14, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (iv) (A ") SEQ ID NO: 18, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof.
[74]
74. The kit of any one of claims 57 to 65, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (ID (e).
[75]
75. The kit of any one of claims 57 to 74, wherein if the kit comprises the second combination of amplification oligomers, then said kit further comprises a CFB-specific detection probe oligomer comprising a sequence of. Target hybridization of a CFB-specific detection probe that is about 15 to about 35 nucleotides in length and that is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second amplification oligomers specific to CFB. CFB.
[76]
76. The kit of claim 75, wherein the first and second CFB specific target hybridization sequences are the target hybridization sequences of (ID) (b) and the target CFB specific detection probe hybridization sequence. is SEQ ID NO: 24, or an RNA equivalent or DNA / RNA chimera thereof.
[77]
TT. The kit of claim 75, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (d) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 25, or an RNA equivalent or DNA / RNA chimera thereof.
[78]
78. The kit of claim 75, wherein the first and second CFB-specific target hybridization sequences BE2019 / 5528 are the target hybridization sequences of (I) (a) and the detection probe target hybridization sequence. specific to CFB is SEQ ID NO: 22 or SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[79]
79. The kit of claim 75, wherein the first and second CFB specific target hybridization sequences are the target hybridization sequences of (TI) (c) and the target CFB specific detection probe hybridization sequence. is SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[80]
80. A kit according to any one of claims 75 to 79, wherein the CFB-specific detection probe oligomer further comprises a detectable label.
[81]
81. Kit according to claim 80, in which the detectable label is a label - fluorescent or chemiluminescent.
[82]
82. The kit of claim 80, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[83]
83. A kit according to any one of claims 57 to 82, wherein said kit comprises both the first and second combinations of amplification oligomers.
[84]
84. A kit for determining the presence or absence of group B streptococci (GBS) in a sample, said kit comprising: a combination of amplification oligomers comprising first and second amplification oligomers specific for S / P capable of amplifying a target region of an S7P to GBS target nucleic acid, wherein the first and second S / P specific amplification oligomers comprise, respectively, first (A) and second (B) hybridization sequences S / P-specific targets selected from the group consisting of (a) (A) SEQ ID No. "3, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID No: 4, or an RNA equivalent or DNA / RNA chimera thereof; and
(b) (A) SEQ ID No: 7, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof, and (B) SEQ ID No: 8, or an equivalent of RNA or a DNA / RNA chimera thereof.
[85]
85. The kit of claim 84, wherein the first and second target hybridization sequences specific to SIP are the target hybridization sequences of (a).
[86]
86. The kit of claim 84, wherein the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (b).
[87]
87. The kit of any one of claims 84 to 86, wherein said kit further comprises a SIP-specific detection probe oligomer comprising a S / P-specific detection probe target hybridization sequence which has a length of about 15 to about 35 nucleotides and which is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second S / P specific amplification oligomers.
[88]
88. The kit of claim 87, wherein the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (a) and the SIP-specific detection probe target hybridization sequence is. SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof.
[89]
89. The kit of claim 88, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b) and the SIP-specific detection probe target hybridization sequence is SEQ. ID NO: 11, or an RNA equivalent or DNA / RNA chimera thereof.
[90]
90. A kit according to any one of claims 87 to 89, wherein the detection probe oligomer further comprises a detectable label.
[91]
91. Kit according to claim 90, in which the detectable label is a fluorescent or chemiluminescent label.
[92]
92. The kit of claim 90, wherein the detectable label is a fluorescent BE2019 / 5528 label and the detection probe oligomer further comprises a non-fluorescent quencher.
[93]
93. A kit according to any one of claims 84 to 92, further comprising a second combination of amplification oligomers capable of amplifying a target region of a target nucleic acid CFB to GBS.
[94]
94. A kit for determining the presence or absence of group B streptococci (GBS) in a sample, said kit comprising: a combination of amplification oligomers comprising first and second CFB-specific amplification oligomers capable of '' amplifying a target region of a CFB to GBS target nucleic acid, wherein the first and second CFB-specific amplification oligomers comprise, respectively, first (A) and second (B) CFB-specific target hybridization sequences , the first target hybridization sequence consisting of a sequence selected from (a) (A), (b) (A), (c) (A), or (d) (A) and the second target hybridization sequence consisting of a target hybridization sequence selected from (a) (B), (b) (B), (c) (B) or (d) (B) respectively, where (a) (A) (B) , (b) (A) (B), (c) (A) (B) and (d) (A) (B) are as follows: (a) (A) SEQ ID NO: 12 or SEQ ID N °: 14, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID N °: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; (b) (A) SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof; and (d) (A) SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
[95]
95. The kit of claim 94, wherein the first and second CFB-specific target hybridization sequences BE2019 / 5528 are the target hybridization sequence of (b).
[96]
96. The kit of claim 94, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d).
[97]
97. The kit of claim 94, wherein the target hybridization sequences specific to CFB are the target hybridization sequences of (a).
[98]
98. The kit of claim 97, wherein the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a DNA construct. RNA of it.
[99]
99. The kit of claim 98, wherein the first CFB-specific target hybridization sequence of (a) is present in the sequence of SEQ ID NO: 27, or an equivalent of RNA or a DNA construct. RNA of it.
[100]
100. The kit of claim 99, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID No: 12 or SEQ ID No: 14, or an RNA equivalent or a chimera d. DNA / RNA thereof.
[101]
101. The kit of claim 97, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof. .
[102]
102. The kit of claim 97, wherein the first (A) and second (B) CFB-specific target hybridization sequences of (a) are selected from the group consisting of () (A) SEQID NO: 12, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 13, or an RNA equivalent or a DNA / RNA chimera thereof; (ii) (A) SEQ ID NO: 12, or an RNA equivalent or a DNA / RNA chimera thereof, and
(B) SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera of BE2019 / 5528 thereof; (c) (A) SEQ ID No: 14, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (iv) (A) SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof.
[103]
103. The kit of claim 94, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (c).
[104]
104. The kit of any one of claims 94 to 103, wherein said kit further comprises a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence which has a length of. about 15 to about 35 nucleotides and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB-specific amplification oligomers.
[105]
105. The kit of claim 104, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b) and the CFB-specific detection probe target hybridization sequence is SEQ ID No: 24, or an RNA equivalent or DNA / RNA chimera thereof.
[106]
106. The kit of claim 104, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d) and the CFB-specific detection probe target hybridization sequence is SEQ ID No: 25, or an RNA equivalent or DNA / RNA chimera thereof.
[107]
107. The kit of claim 104, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 22 or SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[108]
108. The kit of claim 104, wherein the first and second CFB-specific target hybridization sequences BE2019 / 5528 are the target hybridization sequences of (c) and the CFB-specific detection probe target hybridization sequence. is SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[109]
109. A kit according to any one of claims 104 to 108, wherein the detection probe oligomer further comprises a detectable label.
[110]
110. The kit of claim 109, wherein the detectable label is a label - fluorescent or chemiluminescent.
[111]
111. The kit of claim 109, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[112]
112. A kit according to any one of claims 94 to 111, further comprising a second combination of amplifying oligomers capable of amplifying a target region of a target nucleic acid S / P to GBS.
[113]
113. A method for determining the presence or absence of group B streptococci (GBS) in a sample, said method comprising: (1) contacting a sample suspected of containing GBS having a first combination of amplification oligomers and / or a second combination of amplification oligomers, wherein (D the first combination of amplification oligomers comprises first and second S / P-specific amplification oligomers for amplifying a target region of a GBS S / P target nucleic acid, wherein the first and second SIP specific amplification oligomers comprise, respectively, selected first (A) and second (B) target specific S / P hybridization sequences in the group consisting of (a) (A) SEQ ID NO: 3, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID No: 4, or an equivalent RNA or a DNA / RNA chimera thereof; and
(b) (A) SEQ ID No: 7, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof, and (B) SEQ ID No: 8, or an equivalent of RNA or a DNA / RNA chimera thereof; and (ID the second combination of amplification oligomers comprises first and second CFB-specific amplification oligomers for amplifying a target region of a CFB-to-GBS target nucleic acid, wherein the first and second amplification oligomers CFB-specific include, respectively, first (A) and second (B) CFB-specific target hybridization sequences selected from the group consisting of (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID No: 26, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 13 or SEQ ID No: 15, or an RNA equivalent or a DNA / RNA chimera thereof; (b) (A) SEQ ID NO: 16, or an RNA equivalent or a DNA / RNA chimera thereof; , and (B) SEQ ID NO: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and (d) (A ") SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 21, or an equivalent of 'RNA or a DNA / RNA chimera thereof; (2) performing an in vitro nucleic acid amplification reaction, wherein any target nucleic acid S / P and / or CFB to GBS, if present in the sample, is used as a template to generate at least one amplicon corresponding to the S / P and / or CFB region; and (3) detecting the presence or absence of au minus one amplicon, thereby determining the presence or absence of GBS in the sample.
[114]
114. The method of claim 113, wherein the method comprises contacting BE2019 / 5528 of the sample with the first and second combinations of amplification oligomers.
[115]
115. The method of claim 114, wherein the method is a multiplex method comprising contacting the sample with the first and second combinations of amplifying oligomers in the same reaction mixture.
[116]
116. The method of any one of claims 113 to 115, wherein the first and second S / P specific target hybridization sequences are the target hybridization sequences of (D (a).
[117]
117. The method of claim 113-115, wherein the first and second S7P-specific target hybridization sequences are the target hybridization sequences of (I) (b).
[118]
118. The method of any one of claims 113 to 117, wherein if said method comprises contacting the sample with the first combination of amplifying oligomers, then the detecting step comprises contacting of the in vitro nucleic acid amplification reaction with an S / P-specific detection probe oligomer, comprising an S / P-specific detection probe target hybridization sequence which is about 15 to 15 minutes long. - approximately 35 nucleotides and which is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second amplification oligomers specific to S / P.
[119]
119. The method of claim 118, wherein the first and second S / P specific target hybridization sequences are the target hybridization sequences of (I) (a) and the target detection probe hybridization sequence. specific to SIP is SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof.
[120]
120. The method of claim 118, wherein the first and second SZP-specific target hybridization sequences are the target hybridization sequences of (I) (b) and the target hybridization sequence of SZP-specific detection probe. SIP is SEQ ID NO: 11, or an RNA equivalent or DNA / RNA chimera thereof.
[121]
121. The method of any of claims 118 to 120, wherein the S / P-specific detection probe oligomer further comprises a detectable label.
[122]
122. The method of claim 121, wherein the detectable label is a fluorescent or chemiluminescent label.
[123]
123. The method of claim 121, wherein the detectable label is a fluorescent label and the S / P-specific detection probe oligomer further comprises a non-fluorescent quencher.
[124]
124. The method of any one of claims 113 to 123, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (ID (b).
[125]
125. The method of any one of claims 113 to 123, wherein the first and second CFB specific target hybridization sequences are the target hybridization sequences of (ID (d).
[126]
126. The method of any one of claims 113 to 123, wherein the target hybridization sequences specific to CFB are the target hybridization sequences of (ID (a).
[127]
127. The method of claim 126, wherein the first CFB-specific target hybridization sequence of (II) (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a chimera d. DNA / RNA thereof.
[128]
128. The method of claim 127, wherein the first CFB-specific target hybridization sequence of (ID) (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or a chimera d. DNA / RNA thereof.
[129]
129. The method of claim 128, wherein the first CFB-specific target hybridization sequence of (IT) (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or a chimera. DNA / RNA thereof.
[130]
130. The method of claim 126, wherein the first CFB-specific target hybridization sequence of (II) (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera of. this one.
[131]
131. The method of claim 126, wherein the first (A ") and second (B) CFB-specific target hybridization sequences of (ID) (a) are selected from the group consisting of (1) (A) SEQ ID NO: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 13, or an equivalent of RNA or a DNA chimera / RNA thereof; (ii) (A) SEQ ID NO: 12, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof; (iii) (A ") SEQ ID NO: 14, or an RNA equivalent or a DNA / RNA chimera thereof , and (B ') SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; and (iv) (A) SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof.
[132]
132. The method of any one of claims 113 to 123, wherein the first and second target hybridization sequences specific to CFB are the target hybridization sequence of (ID) (c).
[133]
133. The method of any one of claims 113 to 132, wherein if said method comprises contacting the sample with the second combination of amplifying oligomers, then the detecting step comprises contacting of the in vitro nucleic acid amplification reaction with a CFB-specific detection probe oligomer, comprising a CFB-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB-specific amplification oligomers.
[134]
134. The method of claim 133, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (b) and the target CFB-specific detection probe hybridization sequence is. SEQ ID NO: 24, or an RNA equivalent BE2019 / 5528 or a DNA / RNA chimera thereof.
[135]
135. The method of claim 133, wherein the first and second CFB specific target hybridization sequences are the target hybridization sequences of (I) (d) and the target CFB specific detection probe hybridization sequence. is SEQ ID NO: 25, or an RNA equivalent or DNA / RNA chimera thereof.
[136]
136. The method of claim 133, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (D) (a) and the target hybridization sequence of CFB-specific detection probe. CFB is SEQ ID NO: 22 or SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[137]
137. The method of claim 133, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (ID) (c) and the target hybridization sequence of specific CFB detection probe. CFB is SEQ ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[138]
138. The method of any one of claims 133 to 137, wherein the CFB-Specific detection probe oligomer further comprises a detectable label.
[139]
139. The method of claim 138, wherein the detectable label is a fluorescent or chemiluminescent label.
[140]
140. The method of claim 138, wherein the detectable label is a fluorescent label and the CFB-specific detection probe oligomer further comprises a non-fluorescent quencher.
[141]
141. A method according to any one of claims 188 to 120 and 133 to 137, wherein the detection step is performed in real time.
[142]
142. The method of any one of claims 113 to 141, wherein the in vitro nucleic acid amplification reaction is a PCR amplification reaction.
[143]
143. The method of claim 114 or 115, wherein the detecting step comprises contacting the in vitro nucleic acid amplification reaction with (i) a SIP-specific detection probe oligomer. comprising an S / P-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in an S / P amplicon amplicon amplicon. first and second S / P-specific amplification oligomers, and (it) a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence that is from about to about 35 in length nucleotides and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB-specific amplification oligomers, wherein each of said SIP-specific detection probe oligomers and CFB comprises a fluorescent marker and a non-fluorescent quencher.
15
[144]
144. The method of claim 143, wherein the in vitro nucleic acid amplification reaction is a real-time PCR amplification reaction.
[145]
145. A method for determining the presence or absence of group B streptococci (GBS) in a sample, said method comprising: (1) contacting a sample suspected of containing GBS with a combination of oligomers amplification comprising first and second S / P specific amplification oligomers for amplifying a target region of a S / P to GBS target nucleic acid, wherein the first and second S / P specific amplification oligomers comprise, respectively, first (A) and second (B) target hybridization sequences specific to S / P selected from the group consisting of (a) (A) SEQ ID NO: "3, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 4, or an RNA equivalent or a DNA / RNA chimera thereof; and (b) (A) SEQ ID NO: 7, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 8, or an equivalent of RNA or a DNA / RNA chimera. of it;
(2) performing an in vitro nucleic acid amplification reaction, in which BE2019 / 5528 any target nucleic acid S / P to GBS, if present in the sample, is used as a template to generate at least one amplicon corresponding to the S / P region; and (3) detecting the presence or absence of the amplicon, thereby determining the presence or absence of GBS in the sample.
[146]
146. The method of claim 145, wherein the first and second target hybridization sequences specific to SIP are the target hybridization sequences of (a).
[147]
147. The method of claim 145, wherein the first and second S / P specific target hybridization sequences are the target hybridization sequences of (b).
[148]
148. The method of any one of claims 145 to 147, wherein the detecting step comprises contacting the in vitro nucleic acid amplification reaction with an S / P-specific detection probe oligomer. , comprising an S / P-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in an S / P amplicon amplifiable by the first and second SIP specific amplification oligomers.
[149]
149. The method of claim 148, wherein the first and second S / P-specific target hybridization sequences are the target hybridization sequences of (a) and the SIP-specific detection probe target hybridization sequence is. SEQ ID NO: 9, or an RNA equivalent or DNA / RNA chimera thereof.
[150]
150. The method of claim 148, wherein the first and second SIP-specific target hybridization sequences are the target hybridization sequences of (b) and the SIP-specific detection probe target hybridization sequence is SEQ ID No: 11, or an RNA equivalent or DNA / RNA chimera thereof.
[151]
151. The method of any of claims 145 to 150, wherein the detection probe oligomer further comprises a detectable label.
[152]
152. The method of claim 151, wherein the detectable label is a fluorescent or chemiluminescent label.
[153]
153. The method of claim 151, wherein the detectable label is a fluorescent label and the detection probe oligomer further comprises a non-fluorescent quencher.
[154]
154. A method according to any one of claims 145 to 150, wherein the detection step is performed in real time.
[155]
155. The method of any of claims 145 to 154, wherein the in vitro nucleic acid amplification reaction is a PCR amplification reaction.
[156]
156. The method of claim 153, wherein the in vitro nucleic acid amplification reaction is a real-time PCR amplification reaction.
[157]
157. The method of any one of claims 145 to 156, further comprising contacting the sample with a second combination of amplification oligomers comprising first and second CFB-specific amplification oligomers for amplifying. a target region of a CFB to GBS target nucleic acid, in which, in the amplification step, any CFB to GBS target nucleic acid, if present in the sample, is used as a template to generate an amplicon corresponding to the target region CFB, and wherein the detecting step comprises detecting the presence or absence of the amplicon corresponding to the target region CFB.
[158]
158. A method for determining the presence or absence of group B streptococci (GBS) in a sample, said method comprising: (1) contacting a sample suspected of containing GBS with a combination of oligomers amplification comprising first and second CFB-specific amplification oligomers for amplifying a target region of a CFB-to-GBS target nucleic acid, wherein the first and second SIP-specific amplification oligomers - comprise, respectively, first (A) and second (B) target hybridization sequences specific to S / P, the first target hybridization sequence consisting of a sequence selected from (a) (A), (b) (A), (c) (A), or (d) (A) and the second target hybridization sequence consisting of a sequence selected from (a) (B), (b) (B), (c) (B) or (d) ( B) respectively, where (a) (A) (B), (b) (A) (B) and (c) (A) (B) and (d) (A) (B) are as follows:
(a) (A) SEQ ID No: 12 or SEQ ID No: 14, or an equivalent of RNA or a DNA / RNA chima # & F2019 / 5528 thereof, and (B) SEQ ID NN °: 13 or SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof; (b) (A) SEQ ID NO: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof; and (d) (A) SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof; (2) performing an in vitro nucleic acid amplification reaction, in which any CFB to GBS target nucleic acid, if present in the sample, is used as a template to generate at least one corresponding amplicon to the CFB regions; and (3) detecting the presence or absence of the amplicon, thereby determining the presence or | absence of GBS in the sample.
[159]
159. The method of claim 158, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (b).
[160]
160. The method of claim 158, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d).
[161]
161. The method of claim 158, wherein the target hybridization sequences specific to CFB are the target hybridization sequences of (a).
[162]
162. The method of claim 161, wherein the first CFB-specific target hybridization sequence of (a) comprises at least the sequence of SEQ ID NO: 28, or an RNA equivalent or a DNA construct. RNA of it.
[163]
163. The method of claim 162, wherein the first CFB-specific target hybridization sequence of (a) is present in the sequence of SEQ ID NO: 27, or an RNA equivalent or a DNA construct. RNA of it.
[164]
164. The method of claim 163, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 12 or SEQ ID NO: 14, or an RNA equivalent or a chimera of. DNA / RNA thereof.
[165]
165. The method of claim 161, wherein the first CFB-specific target hybridization sequence of (a) is SEQ ID NO: 18, or an RNA equivalent or DNA / RNA chimera thereof. .
[166]
166. The method of claim 161, wherein the first (A) and second (B) - CFB-specific target hybridization sequences of (a) are selected from the group consisting of (1) (A) SEQ ID NO: : 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 13, or an equivalent of RNA or a DNA / RNA chimera thereof, this ; (ii) (A) SEQ ID NO: 12, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; (iii) (A) SEQ ID No: 14, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (iv) (A) SEQ ID NO: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 15, or an equivalent of RNA or a DNA / RNA chimera thereof.
[167]
167. The method of claim 158, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequence of (c).
[168]
168. The method of any one of claims 158 to 167, wherein the detecting step comprises contacting the in vitro nucleic acid amplification reaction with a specific detection probe target hybridization sequence. to CFB which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in a CFB amplicon amplifiable by the first and second CFB specific amplification oligomers.
[169]
169. The method of claim 168, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (b) and the CFB-specific detection probe target hybridization sequence is SEQ ID NO: 24, or an RNA equivalent or DNA / RNA chimera thereof.
[170]
170. The method of claim 168, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (d) and the CFB-specific detection probe target hybridization sequence is SEQ. ID NO: 25, or an RNA equivalent or DNA / RNA chimera thereof.
[171]
171. The method of claim 168, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (a) and the CFB-specific detection probe target hybridization sequence is. SEQ ID NO: 22 or SEQ ID NO: 23, or an RNA equivalent or a DNA / RNA chimera thereof.
[172]
172. The method of claim 168, wherein the first and second CFB-specific target hybridization sequences are the target hybridization sequences of (c) and the CFB-specific detection probe target hybridization sequence is SEQ. ID NO: 23, or an RNA equivalent or DNA / RNA chimera thereof.
[173]
173. The method of any of claims 168 to 172, wherein the detection probe oligomer further comprises a detectable label.
[174]
174. The method of claim 173, wherein the detectable label is a fluorescent or chemiluminescent label.
[175]
175. The method of claim 173, wherein the detectable label is a fluorescent label BE2019 / 5528 and the detection probe oligomer further comprises a non-fluorescent quencher.
[176]
176. The method of any one of claims 168 to 172, wherein the step of detecting is performed in real time.
[177]
177. The method of any of claims 168 to 176, wherein the in vitro nucleic acid amplification reaction is a PCR amplification reaction.
[178]
178. The method of claim 175, wherein the in vitro nucleic acid amplification reaction is a real-time PCR amplification reaction.
[179]
179. The method of any of claims 168 to 178, further comprising contacting the sample with a second combination of amplification oligomers comprising first and second SIP-specific amplification oligomers for amplifying. a target region of an S / P to GBS target nucleic acid, in which, in the amplification step, any S / P to GBS target nucleic acid, if present in the sample, is used as a template to generate an amplicon corresponding to the S / P target region, and wherein the detecting step comprises detecting the presence or absence of the amplicon corresponding to the S / P target region.
[180]
180. A method according to any one of claims 113 to 179, wherein the method determines the presence or absence of one of the GBS serotypes Ia, Ib, Ic, II, III, IV, V, VL VIL VIII and DX.
[181]
181. The method of claim 181, wherein the method further determines the presence or absence of a nonhemolytic strain of GBS.
[182]
182. A detection probe oligomer comprising: an S7P-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured to hybridize to a target sequence present in an amplicon S / P amplifiable by a first combination of amplification oligomers which comprises first and second amplification oligomers specific for S / P capable of amplifying a target region of a group B streptococcal SP target nucleic acid BE2019 / 5528 (GBS), the first and second S / P specific amplification oligomers comprising respectively a first (A) and a second (B) S / P specific target hybridization sequences selected from the group consisting of (a) ( A) SEQ ID NO: "3, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 4, or an equivalent of RNA or a chimera of DNA / RNA thereof; and (b) (A) SEQ ID NO: 7, or an RNA equivalent or DNA / RNA chimera thereof, e t (B) SEQ ID NO: 8, or an RNA equivalent or DNA / RNA chimera thereof.
[183]
183. A detection probe oligomer comprising: a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured for s '' hybridize to a target sequence present in an S / P amplicon amplifiable by a second combination of amplification oligomers which comprises first and second CFB-specific amplification oligomers capable of amplifying a target region of a nucleic acid CFB group B streptococcus (GBS) target, the first and second CFB-specific amplification oligomers respectively comprising a first (A) and a second (B ') CFB-specific target hybridization sequences, the first sequence of target hybridization consisting of a sequence selected from (a) (A '), (b) (A'), (c) (A '), or (d) (A') and the second target hybridization sequence consisting of a sequence chosen from (a) (B '), (b) (B'), (c) (B ') or (d ) (B ') respectively, in which (a) (A') (B '), (b) (A') (B ') and (c) (A') (B ') and (d) (A ') (B') are as follows: (a) (A) SEQ ID No: 12 or SEQ ID No: 14, or an RNA equivalent or a DNA / RNA chimera thereof, and (B ') SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or a DNA / RNA chimera thereof; (b) (A) SEQ ID No: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof;
(c) (A ") SEQ ID No: 18, or an equivalent of RNA or a DNA / RNA chimera of BE2019 / 5528 thereof, and (B) SEQ ID No: 15, or an equivalent RNA or a DNA / RNA chimera thereof; and (d) (A ") SEQ ID NO: 20, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an RNA equivalent or DNA / RNA chimera thereof.
[184]
184. The detection probe oligomer of claim 182 or 183, wherein the detection probe oligomer further comprises a detectable label.
[185]
185. A detection probe oligomer of claim 184, wherein the detectable label is a fluorescent or chemiluminescent label.
[186]
186. A composition comprising: (1) an S / P-specific detection probe oligomer comprising a SIP-specific detection probe target hybridization sequence which is from about 15 to about 35 nucleotides in length and which is configured to. hybridize to a target sequence present in an SZP amplicon amplifiable by a first combination of amplification oligomers which comprises first and second SZP-specific amplification oligomers capable of amplifying a target region of a target nucleic acid Group B streptococcal SZP (GBS), the first and second SIP-specific amplification oligomers comprising respectively a first (A) and a second (B) SIP-specific target hybridization sequences selected from the group consisting of (a ) (A) SEQ ID NO: 3, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID No: 4, or an equivalent of RNA or a chimera d DNA / RNA thereof; and (b) (A) SEQ ID NO: 7, or an RNA equivalent or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 8, or an RNA equivalent or a DNA / RNA chimera thereof; and (2) a CFB-specific detection probe oligomer comprising a CFB-specific detection probe target hybridization sequence that is from about 15 to about
35 nucleotides and which is configured to hybridize to a target sequence present in a BE2019 / 5528 S / P amplicon amplifiable by a second combination of amplification oligomers which comprises first and second CFB-specific amplification oligomers capable of '' amplifying a target region of a group B streptococcal CFB (GBS) target nucleic acid, the first and second CFB-specific amplification oligomers respectively comprising a first (A) and a second (B ') hybridization sequences CFB-specific targets selected from the group consisting of (a) (A) a sequence which is from about 17 to about 24 contiguous nucleotides present in the sequence of SEQ ID NO: 26, or an RNA equivalent or chimera DNA / RNA thereof, and (B) SEQ ID NO: 13 or SEQ ID NO: 15, or an RNA equivalent or DNA / RNA chimera thereof; (b) (A) SEQ ID No: 16, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 17, or an equivalent of RNA or a DNA / RNA chimera thereof; (c) (A) SEQ ID No: 18, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B ') SEQ ID No: 15, or an equivalent of RNA or a DNA / RNA chimera thereof; and (d) (A ") SEQ ID NO: 20, or an equivalent of RNA or a DNA / RNA chimera thereof, and (B) SEQ ID NO: 21, or an equivalent of RNA or a DNA / RNA chimera thereof.
[187]
187. The composition of claim 186, wherein the S / P-specific detection probe oligomer further comprises a detectable label.
[188]
188. The composition of claim 186 or 187, wherein the CFB-specific detection probe oligomer further comprises a detectable label.
[189]
189. The composition of claim 187 or 188, wherein the detectable label is a fluorescent or chemiluminescent label.
[190]
190. An aqueous formulation for the amplification of group B streptococcal nucleic acid (GBS), wherein the aqueous formulation comprises:
a composition according to any one of claims 1 to 56, and BE2019 / 5528 an organic buffer.
[191]
191. An aqueous formulation according to claim 190, further comprising a DNA polymerase enzyme.
[192]
192. An aqueous formulation according to claim 190 or 191, further comprising a reverse transcriptase enzyme.
[193]
193. An aqueous formulation according to any one of claims 190 to 192, further comprising a detection probe oligomer.
[194]
194. An aqueous formulation according to any one of claims 190 to 193, further comprising a blowing agent selected from the group consisting of trehalose, raffinose, and a combination thereof.
[195]
195. An aqueous formulation according to any one of claims 190 to 194, wherein the formulation contains an inorganic salt at a concentration of 4 mM or less.
[196]
196. A dried formulation for the amplification of group B streptococcal nucleic acid (GBS), wherein the aqueous formulation comprises: a composition according to any one of claims 1 to 56, and a swelling agent.
[197]
197. A dried formulation according to claim 196, wherein the blowing agent is selected from the group consisting of trehalose, raffinose, and a combination thereof.
[198]
198. A dried formulation according to claim 196 or 197, further comprising an inorganic salt, wherein the weight percent of the inorganic salt relative to the weight of the dried formulation is less than or equal to 0.249%.
[199]
199. A dried formulation according to any one of claims 196 to 198, further comprising a DNA polymerase enzyme.
[200]
200. A dried formulation according to any one of claims 196 to 199, further comprising a reverse transcriptase enzyme.
[201]
201. A dried formulation according to any one of claims 196 to 200, further comprising a detection probe oligomer.
[202]
202. A dried formulation according to any one of claims 196 to 201, wherein the formulation is a lyophilized formulation.
[203]
203. An aqueous formulation for the detection of Group B Streptococcus (GBS) nucleic acid, wherein the aqueous formulation comprises: a detection probe oligomer according to any one of claims 182 to 185 or a composition according to l any of claims 186 to 189, and an organic buffer.
[204]
204. An aqueous formulation according to claim 203, further comprising a surfactant.
[205]
205. An aqueous formulation according to claim 204, wherein the surfactant is a non-linear surfactant.
[206]
206. An aqueous formulation according to claim 204, wherein the surfactant is selected from the group consisting of polyethylene glycol mono [4- (1,1,3,3-tetramethylbutyl) phenyl] ether, polysorbate and a combination of those. -this.
[207]
207. An aqueous formulation according to any one of claims 204 to 206, further comprising a DNA polymerase enzyme.
[208]
208. An aqueous formulation according to any one of claims 204 to 207, further comprising a reverse transcriptase enzyme.
[209]
209. An aqueous formulation according to any one of claims 204 to 208, BE2019 / 5528 further comprising at least one amplifying oligomer.
[210]
210. An aqueous formulation according to any one of claims 204 to 209, further comprising a blowing agent selected from the group consisting of trehalose, raffinose, and a combination thereof.
[211]
211. An aqueous formulation according to any one of claims 204 to 210, wherein the formulation contains an inorganic salt at a concentration of 4 mM or less.
[212]
212. A dried formulation for the detection of group B streptococcus (GBS) nucleic acid, wherein the dried formulation comprises: a detection probe oligomer according to any one of claims 182 to 185 or a composition according to any of claims 186 to 189, and a blowing agent.
[213]
213. The dried formulation of claim 212, wherein the blowing agent is selected from the group consisting of trehalose, raffinose, and a combination thereof.
[214]
214. A dried formulation according to claim 212 or 213, further comprising an inorganic salt, wherein the weight percent of the inorganic salt based on the weight of the dried formulation is less than or equal to 0.249%.
[215]
215. A dried formulation according to any one of claims 212 to 214, further comprising a DNA polymerase enzyme.
[216]
216. A dried formulation according to any one of claims 212 to 215, further comprising a reverse transcriptase enzyme.
[217]
217. A dried formulation according to any one of claims 212 to 216, further comprising at least one amplifying oligomer.
[218]
218. A dried formulation according to any one of claims 212 to 217, further comprising a surfactant.
[219]
219. A dried formulation according to claim 218, wherein the surfactant is a non-linear surfactant.
[220]
220. The dried formulation of claim 218, wherein the surfactant is selected from the group consisting of polyethylene glycol mono [4- (1,1,3,3-tetramethylbutyl) phenyl] ether, polysorbate and a combination of those. -this.
[221]
221. A dry formulation according to any one of claims 212 to 220, wherein the formulation is a lyophilized formulation.
[222]
222. A reaction mixture for the amplification of group B streptococcal nucleic acid (GBS), wherein the reaction mixture comprises an aqueous formulation according to any one of claims 190 to 195.
[223]
223. Reaction mixture for amplification of group B streptococcal nucleic acid (GBS), in which the reaction mixture is reconstituted using water or an organic buffer from a formulation dried according to any one of claims 196 to 202.
[224]
224. The reaction mixture according to claim 223, wherein the reaction mixture - contains an inorganic salt.
[225]
225. The reaction mixture of claim 224, wherein the inorganic salt is selected from the group consisting of magnesium, potassium, and sodium.
[226]
226. The reaction mixture according to claim 224 or 225, wherein the concentration of the inorganic salt is less than or equal to 4 mM.
[227]
227. A reaction mixture for the detection of BE2019 / 5528 group B streptococcal nucleic acid (GBS), wherein the reaction mixture comprises an aqueous formulation according to any one of claims 203 to 211.
[228]
228. Reaction mixture for the detection of group B streptococcal nucleic acid (GBS) in which the reaction mixture is reconstituted with water or an organic buffer from a dried formulation according to any one of claims 212 to 221.
[229]
229. The reaction mixture according to claim 228, wherein the reaction mixture contains an inorganic salt.
[230]
230. A reaction mixture according to claim 229, wherein the inorganic salt is selected from the group consisting of magnesium, potassium and sodium.
[231]
231. The reaction mixture according to claim 229 or 230, wherein the concentration of the inorganic salt is less than or equal to 4 mM.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10961594B2|2021-03-30|Compositions to detect Atopobium vaginae nucleic acid

---

US10415099B2|2019-09-17|Compositions and methods for detecting BV-associated bacterial nucleic acid

---

US20180044720A1|2018-02-15|Compositions and methods for detecting bv-associated bacterial nucleic acid

---

JPH09511658A|1997-11-25|Amplification and detection of Mycobacterium avium complex

---

BE1026527B1|2020-10-12|COMPOSITIONS AND METHODS FOR DETECTION OF GROUP B NUCLEIC STREPTOCOCCAL ACID

---

JPH09248193A|1997-09-22|Amplification and detection of mycobacterium avium complex species

---

US10626470B2|2020-04-21|Compositions and methods to detect Legionella pneumophila nucleic acid

---

US20210207195A1|2021-07-08|Compositions and Methods for Detecting Bordetella Pertussis and Bordetella Parapertussis Nucleic Acid

---

US11111549B2|2021-09-07|Methods and compositions for detecting Candida species

---

WO2020028631A1|2020-02-06|Compositions and methods for detecting nucleic acids of epstein-barr virus

---

CA3144452A1|2021-01-07|Oligonucleotides for use in determining the presence of trichomonas vaginalis in a sample

---

WO2021127099A1|2021-06-24|Compositions and methods for detecting coronavirus nucleic acid

---

WO2021046270A1|2021-03-11|Detection of chlamydia trachomatis nucleic acid variants

同族专利:

---

公开号 | 公开日

---

CA3103442A1|2019-12-19|

---

BE1026527A1|2020-03-04|

---

FR3087205A1|2020-04-17|

---

GB202100233D0|2021-02-24|

---

CN112654721A|2021-04-13|

---

GB202104190D0|2021-05-12|

---

GB202104178D0|2021-05-12|

---

GB202104181D0|2021-05-12|

---

GB2597566A|2022-02-02|

---

AU2019286648A1|2021-01-28|

---

GB2597570A|2022-02-02|

---

GB202104180D0|2021-05-12|

---

GB2590210A|2021-06-23|

---

GB2597567A|2022-02-02|

---

GB2597569A|2022-02-02|

---

DE102019005689B4|2021-02-04|

---

WO2019239394A8|2020-05-28|

---

WO2019239394A1|2019-12-19|

---

DE102019005689A1|2019-12-19|

---

US20200140928A1|2020-05-07|

---

GB2597568A|2022-02-02|

---

GB202104185D0|2021-05-12|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

US20060252064A1|2002-03-20|2006-11-09|Betty Wu|Polynucleotide primers and probes for rapid detection of group B streptococcus |

---

US20100028884A1|2008-05-16|2010-02-04|Medical Diagnostic Laboratories, Llc|Detection of penicillin tolerance in group B streptococcus: single nucleotide polymorphisms in penicillin binding protein 4|

---

CN104730128B|2015-04-02|2017-04-26|重庆医科大学|Electrochemical sensor for detecting group B streptococcus and preparation and application thereof|

---

CN107541509A|2016-06-29|2018-01-05|博奥生物集团有限公司|For detecting the LAMP primer composition and its application of 6 kinds of infectious agents of mastitis for milk cows|

---

WO2019239394A1|2018-06-13|2019-12-19|Gen-Probe Incorporated|Compositions and methods for detecting group b streptococcus nucleic acid|

---

FR2422956B1|1978-04-13|1980-11-28|Pasteur Institut|

---

US4786600A|1984-05-25|1988-11-22|The Trustees Of Columbia University In The City Of New York|Autocatalytic replication of recombinant RNA|

---

US4683202B1|1985-03-28|1990-11-27|Cetus Corp|

---

US4868105A|1985-12-11|1989-09-19|Chiron Corporation|Solution phase nucleic acid sandwich assay|

---

US4683195B1|1986-01-30|1990-11-27|Cetus Corp|

---

US4800159A|1986-02-07|1989-01-24|Cetus Corporation|Process for amplifying, detecting, and/or cloning nucleic acid sequences|

---

DE3785658T2|1986-08-11|1993-08-12|Siska Diagnostics Inc|METHODS AND COMPOSITIONS FOR TESTS WITH NUCLEIC ACID PROBE.|

---

US5541308A|1986-11-24|1996-07-30|Gen-Probe Incorporated|Nucleic acid probes for detection and/or quantitation of non-viral organisms|

---

IL86724A|1987-06-19|1995-01-24|Siska Diagnostics Inc|Method and kits for the amplification and detection of nucleic acid sequences|

---

CA1340843C|1987-07-31|1999-12-07|J. Lawrence Burg|Selective amplification of target polynucleotide sequences|

---

US5639604A|1987-09-21|1997-06-17|Gen-Probe Incorporated|Homogeneous protection assay|

---

US5283174A|1987-09-21|1994-02-01|Gen-Probe, Incorporated|Homogenous protection assay|

---

PT88562B|1987-09-21|1994-02-28|Ml Technology Ventures|METHOD OF TESTING OF HOMOGENEOUS PROTECTION FOR THE DETECTION OF AN ANALITE|

---

US5585481A|1987-09-21|1996-12-17|Gen-Probe Incorporated|Linking reagents for nucleotide probes|

---

US5185439A|1987-10-05|1993-02-09|Gen-Probe Incorporated|Acridinium ester labelling and purification of nucleotide probes|

---

US5124246A|1987-10-15|1992-06-23|Chiron Corporation|Nucleic acid multimers and amplified nucleic acid hybridization assays using same|

---

CA1323293C|1987-12-11|1993-10-19|Keith C. Backman|Assay using template-dependent nucleic acid probe reorganization|

---

US5130238A|1988-06-24|1992-07-14|Cangene Corporation|Enhanced nucleic acid amplification process|

---

US5118801A|1988-09-30|1992-06-02|The Public Health Research Institute|Nucleic acid process containing improved molecular switch|

---

US5656207A|1989-06-24|1997-08-12|Gen Probe Incorporated|Detecting or quantifying multiple analytes using labelling techniques|

---

CA2020958C|1989-07-11|2005-01-11|Daniel L. Kacian|Nucleic acid sequence amplification methods|

---

US5849481A|1990-07-27|1998-12-15|Chiron Corporation|Nucleic acid hybridization assays employing large comb-type branched polynucleotides|

---

US5378825A|1990-07-27|1995-01-03|Isis Pharmaceuticals, Inc.|Backbone modified oligonucleotide analogs|

---

US5210015A|1990-08-06|1993-05-11|Hoffman-La Roche Inc.|Homogeneous assay system using the nuclease activity of a nucleic acid polymerase|

---

JP3131222B2|1991-12-24|2001-01-31|アイシス・ファーマシューティカルス・インコーポレーテッド|2 'modified oligonucleotide having a gap|

---

US5424413A|1992-01-22|1995-06-13|Gen-Probe Incorporated|Branched nucleic acid probes|

---

WO1993022461A1|1992-05-06|1993-11-11|Gen-Probe Incorporated|Nucleic acid sequence amplification method, composition and kit|

---

WO1994003472A1|1992-08-04|1994-02-17|Gen-Probe Incorporated|Nucleic acid sequence amplification|

---

US5422252A|1993-06-04|1995-06-06|Becton, Dickinson And Company|Simultaneous amplification of multiple targets|

---

KR100189229B1|1993-07-23|1999-06-01|다니엘 엘. 캐시앙, 헨리 엘. 노르호프|Methods for enhancing nucleic acid amplification|

---

US5925517A|1993-11-12|1999-07-20|The Public Health Research Institute Of The City Of New York, Inc.|Detectably labeled dual conformation oligonucleotide probes, assays and kits|

---

AU2522095A|1994-05-19|1995-12-18|Dako A/S|Pna probes for detection of neisseria gonorrhoeae and chlamydia trachomatis|

---

EP0709466B1|1994-10-28|2006-09-27|Gen-Probe Incorporated|Compositions and methods for the simultaneous detection and quantification of multiple specific nucleic acid sequences|

---

US5731148A|1995-06-07|1998-03-24|Gen-Probe Incorporated|Adduct protection assay|

---

JP3898228B2|1996-04-12|2007-03-28|ザパブリックヘルスリサーチインスティチュートオブザシティーオブニューヨークインク|Detection probes, kits and assays|

---

DK0975807T3|1997-05-02|2007-01-29|Gen Probe Inc|Two-step hybridization and capture of a polynucleotide|

---

US6180340B1|1997-10-31|2001-01-30|Gen-Probe Incorporated|Extended dynamic range assays|

---

US6361945B1|1998-07-02|2002-03-26|Gen-Probe Incorporated|Molecular torches|

---

US20040009482A1|2002-07-09|2004-01-15|Nanibhushan Dattagupta|Compositions and methods for detecting streptococcus agalactiae surface immunogenic protein genes|

---

WO2004027025A2|2002-09-20|2004-04-01|New England Biolabs, Inc.|Helicase dependent amplification of nucleic acids|

---

US7436965B2|2003-02-19|2008-10-14|Microsoft Corporation|Optical out-of-band key distribution|

---

JP5020818B2|2004-07-01|2012-09-05|ジェン−プローブ・インコーポレーテッド|Methods and compositions for detecting nucleic acids in biological samples|

---

CA2898814C|2004-08-27|2015-12-29|Gen-Probe Incorporated|Single-primer nucleic acid amplification methods|

---

US20060194240A1|2005-02-28|2006-08-31|Gen-Probe Incorporated|Compositions and methods of detecting an analyte by using a nucleic acid hybridization switch probe|

---

WO2008016988A1|2006-08-01|2008-02-07|Gen-Probe Incorporated|Methods of nonspecific target capture of nucleic acids|GB2597569A|2018-06-13|2022-02-02|Gen Probe Inc|Compositions and methods for detecting group B streptococcus nucleic acid|

法律状态:
2020-10-28| FG| Patent granted|Effective date: 20201012 |

优先权:

---

申请号 | 申请日 | 专利标题

---

US201862684317P| true| 2018-06-13|2018-06-13|

---